Home

CytoTrap XR Library Construction Kit INSTRUCTION MANUAL

1. The Xho I digestion releases the EcoR I adapter and residual linker primer from the 3 end of the cDNA These two fragments are separated on a drip Cytotrap XR Library Construction Kit 17 column containing Sepharose CL 2B gel filtration medium The size fractionated cDNA is then precipitated and ligated to the pMyr XR vector Generation of cDNA Inserts Notes The following protocol uses radiolabeled nucleotides in control first and second strand synthesis reactions to assess the quality and the size of the cDNA synthesis products An alternative protocol using SYBR Green II staining instead of P labeling is available in a Technical Note on the Stratagene products website http www stratagene com lit items CDNA Synthesis Kit Using SYBR pdf The following protocol has been optimized for 5 ug of poly A RNA per reaction Protocol Guidelines e The quality and quantity of the mRNA used is of fundamental importance to the construction of a large representative cDNA library see Appendix II RNA Purification and Quantitation The Stratagene RNA Isolation Kit Stratagene Catalog 200345 uses the guanidinium thiocyanate phenol chloroform extraction method which quickly produces large amounts of undegraded RNA To isolate mRNA we offer the Absolutely mRNA Purification Kit Stratagene Catalog 400806 e Secondary structure of mRNA may cause the synthesis of truncated cDNAs To relax secondary structure treatment wi
2. lt chloram phenicol FIGURE 5 Circular maps of the pSos MAFB pMyr MAFB and pMyr SB positive control plasmids Cytotrap XR Library Construction Kit 13 Applications Expected Results The CytoTrap control plasmids are used in pairwise combination as positive and negative controls for the rescue of the temperature sensitive phenotype of cdc25H strain The protein products expressed from pSos MAFB and pMyr MAFB interact with each other in vivo Interaction of the hybrid proteins localizes hSos to the cell membrane activating the Ras pathway and permitting growth of cdc25H mutants at the restrictive temperature of 37 C The pSos MAFB pMyr Lamin C plasmid pair and the pSos Col I pMyr MAFB plasmid pair serve as negative controls since the protein products produced in each of these two pairwise combinations do not interact in vivo thus co transformation does not enable growth of cdc25H mutants at 37 C The pMyr SB plasmid expresses a Sos binding protein fused to the myristylation signal The Sos binding protein interacts with the Sos protein Thus cdc25H yeast cotransformed with pMyr SB and pSos grow at 37 C Cotransformation of pMyr SB with pSos bait plasmid can be used to verify that the Sos bait fusion protein is properly localized in the cytoplasm The expected results for transformation of control plasmids in pairwise combination into the cdc25H strain when plated on selective media and assayed for growth at 37 C are outlin
3. 22 25 C Remove the supernatant Cytotrap XR Library Construction Kit 53 9 Resuspend cells in 0 5 ml of 1 M sorbitol Cotransform pSos bait construct pMyr target library l Select on SD glu UL plates 25 22 days Replica plate on SD gal UL plates at 37 Select for nteractor candidates l Patch interactor candidate colonies on SD glu UL plates 25 C 2 days GAL1 repression Patch repressed interactor candidate colonies in two serial interaction tests 25 SD glu L No Interaction Temp Revert Interaction Select 37 SD glu 1 SD gal m utative positive clones that meet criteria in both rounds l Verification of Interaction Isolate plasmid DNA from pMyr cDNA putative positive Cotransform yeast with pSos bait construct and pMyr cDNA putative positive grow at 25 C patch and assay for growth at 37 C i Positives are confirmed where galactose dependent growth at 37 is observed Further analysis on confirmed positive s Y Cure the pMyr cDNA putative positive colonies harbored in a strain of pSos bait plasmid t Mate cured pMyr cDNA putative positives in the o strain with pSos bait construct in the a strain Grow diploids at 25 Patch and assay for growth at 378 Positives are confirmed where galactose dependent growth at 37 is observed Further analysis on confirmed positive s
4. 4 If the reversion control plates meet the criteria in steps 2 and 3 above evaluate the transformation efficiency for the competent cell preparation Count the number of colonies on plates from transformation 1 Table IV incubated at room temperature 22 25 C For accurate counting there should be at least 30 and no more than 300 cfu plate 5 Calculate the cotransformation efficiency using the following equation The transformation efficiency should be at least 0 5 x 10 1 x 10 cfu ug Number of cfu x Total suspension volume 500 ul cfu ug DNA Transformation efficiency Volume of transformation plated ul x Amount of DNA used 211g 6 If the reversion control and transformation efficiency results are satisfactory proceed to Evaluation of Transformations Prepared to Detect Protein Protein Interactions If single plasmid transformations were performed proceed to Yeast Mating of Single Plasmid Transformants Evaluation of Transformations Prepared to Detect Protein Protein Interactions Note This section describes the processing of transformation reactions prepared according to Table IV in Transforming Yeast and Detecting Protein Protein Interactions 1 Transformation 1 was used to calculate transformation efficiency and to test for reversion of the temperature sensitivity of cdc25H The plates derived from this transformation will not be used further 2 Transformants from reactions 2 3 4 and 9 plated in s
5. FIGURE 9 Library screening procedure for the CytoTrap two hybrid system 54 Cytotrap XR Library Construction Kit 10 Plate the entire transformation reaction in each tube on a 150 mm SD glucose UL agar plate Drop approximately 10 non acid washed glass beads on the plate add the transformation reaction mixture cover the plate and shake or swirl the plate until the mixture is spread out Once the plate is dry pour off the glass beads Note Itis very important to spread the cells using glass beads to achieve an even distribution of yeast colonies on the plates see Additional Materials Required 11 Incubate the inverted plates at room temperature 22 25 C for 48 hours Increased incubation time will increase the sensitivity of detection but will also greatly increase background levels of temperature sensitive revertants The reversion frequency will be evaluated in step 15 Do not incubate the plates for more than 4 days Note It is important that the plates be kept at or below 25 C Higher temperatures may induce mutational revertants 12 Replica plate the transformants onto SD galactose UL agar plates Although no colonies are visible at 48 hours the small colonies may be copied to the new plates by replica plating with the application of firm and even pressure Incubate the plates at 37 C Colonies should start to appear after 3 days 13 Keep the SD glucose plates at room temperature 22 25 C to determine the
6. a or a or both colonies overnight to OD ooo l l Dilute culture to OD oo gt 02 and grow for 3 hours i Plate 75 ul on YPAD agar plate and incubate at 37 C for 4 6 days checking daily for growth Use remainder of culture make yeast competent cells cotransform with transform pSos and pMyr and plate on experimental and control SD glucose UL agar plates reactions incubate at 37 C incubate at 25 C 4 6 days for 4 6 days After 4 6 days examine revertant control plates Wat 37 C to validate assay at 25 C If both the following criteria are met proceed to evaluate experimental and control plates at 25 C 1 30 or fewer colonies on the YPAD plate 2 No colonies on the SD glucose UL agar plates FIGURE 8 Strategy for preparation and phenotypic verification of yeast competent cells 44 Cytotrap XR Library Construction Kit 5 Prepare dilutions of the overnight cultures in 1 or 2 liter flasks for a total diluted culture volume of 300 ml Use the appropriate amount of fresh YPAD medium and of the overnight cultures such that OD q9 0 2 Incubate the cultures at room temperature 22 25 C with shaking at 220 250 rpm for 3 hours 6 Measure the ODgo9 of the cultures It must be 0 7 Plate 75 ul approximately 1 x 106 cells of each culture on a YPAD agar plate seal the plates with Parafilm and incubate the plates at 37 C Observe the plates daily for 4 6 days checking for temperature sensitive
7. add a volume of 100 v v ethanol that is equal to twice the individual sample volume Note The 1x STE buffer contains sufficient NaCl for precipitation 6 Precipitate overnight at 20 C 7 Spin the sample in the microcentrifuge at maximum speed for 60 minutes at 4 C Transfer the supernatant to another tube To ensure that the cDNA has been recovered use a handheld Geiger counter to check the level of radioactivity present in the pellet If the majority of the radiation is detected in the supernatant repeat the centrifugation step otherwise discard the supernatant 8 Carefully wash the pellet with 200 ul of 70 v v ethanol ensuring that the pellet remains undisturbed Do not mix or vortex Spin the sample in a microcentrifuge at maximum speed for 2 minutes at room temperature Remove the ethanol and verify that the pellet has been recovered by visual inspection or with the handheld Geiger counter Vacuum evaporate the pellet for 5 minutes or until dry Do not dry the pellet beyond the point of initial dryness or the cDNA may be difficult to solubilize 9 Using a handheld Geiger counter verify that the cDNA has been recovered and record the number of counts per second cps that is detected for each fraction 10 If 30 cps is detected resuspend each cDNA pellet in 3 5 ul of sterile water If the value is gt 30 cps resuspend the cDNA in 5 ul of sterile water Mix by pipetting up and down Quantitate the cDNA before proc
8. not rise above 16 C Temperatures above 16 C can cause the formation of hairpin structures which are unclonable and interfere with the efficient insertion of correctly synthesized cDNA into the prepared vector After second strand synthesis for 2 5 hours at 16 C immediately place the tube on ice 20 Cytotrap XR Library Construction Kit Blunting the cDNA Termini 1 Add the following to the second strand synthesis reaction 23 ul of blunting dNTP mix 2 ul of cloned Pfu DNA polymerase 2 Quickly vortex the reaction and spin down in a microcentrifuge Incubate the reaction at 72 C for 30 minutes Do not exceed 30 minutes 3 Thaw the 3 M sodium acetate Note X Since radioactivity can leak out between the lid and body of some micro centrifuge tubes during the vortexing and precipitation steps wrap a small piece of Parafilm laboratory film around the rim of the microcentrifuge tube to prevent leakage 4 Remove the reaction and add 200 wl of phenol chloroform 1 1 v v and vortex Note Do not use the low pH phenol from the Stratagene RNA Isolation Kit because this phenol is too acidic and may denature the DNA The phenol must be equilibrated to pH 7 8 5 Spin the reaction in a microcentrifuge at maximum speed for 2 minutes at room temperature and transfer the upper aqueous layer containing the cDNA to a new tube Be careful to avoid removing any interface that may be present 6 Add an equal volume of chloroform
9. revertants If up to the 6th day of incubation more than 30 colonies appear on a plate the yeast competent cell preparation corresponding to that plate is unreliable and all transformants arising from these competent cells are invalid see Evaluation of Control Plates to Determine Success of Yeast Competent Cell Production 7 Pellet the remaining volume of the yeast cultures by centrifugation at 1000 x g for 5 minutes at room temperature Discard the media and resuspend the yeast cell pellets in 50 ml of dH O by repeated pipetting with a 10 ml pipet Spin the yeast cells at 1000 x g for 10 minutes at room temperature 8 Discard the supernatant and resuspend the yeast cell pellet in 50 ml of LiSORB Incubate the cell suspension at room temperature for 30 minutes 9 During this 30 minute incubation of the yeast cells for each of the independent yeast cultures place 400 ul of 20 mg ml sheared salmon sperm DNA in a boiling water bath and incubate for 10 minutes After boiling add 600 ul of LiSORB to each 400 ul salmon sperm DNA and mix by pipetting Cool the salmon sperm DNA mixture to room temperature 10 At the end of the 30 minute incubation pellet the yeast cells by spinning at 1000 x g for 5 minutes at room temperature Resuspend the yeast cell pellets in 300 ul of LiSORB 11 Add 600 ul of salmon sperm DNA mixture from step 9 to the 300 ul of yeast cells from step 10 Mix thoroughly but gently by pipetting 12 Add 5 4
10. 5 end of the MCS and 3 primer is at the 3 end of the MCS Equipment Nondenaturing acrylamide gel 5 see Preparation of Media and Reagents Replica plating mold 150 mm and velvet squares Ribonuclease RNase free microcentrifuge tubes Disposable plastic 10 ml syringes sterile e g B D 10 cc syringe with a Luer Lok tip or equivalent Disposable 18 gauge 114 inch needles sterile e g B D PrecisionGlide needle or equivalent Disposable plastic 1 ml pipets negatively graduated and sterile e g BD Falcon 7520 1 ml serological pipet 1 ml or equivalent Pasteur pipet Portable radiation monitor Geiger counter Water baths 4 8 12 16 30 37 42 65 70 and 72 C Microcentrifuge Micropipet and micropipet tips Vacuum evaporator Incubator 37 C 14 ml BD Falcon polypropylene round bottom tubes BD Biosciences Catalog 352059 96 well plates Whatman No 1 qualitative filter paper Grade 1 Fisher Scientific Pittsburgh Pennsylvania Catalog 09 805C 7 cm diameter and 09 805F 12 5 cm diameter VWRobrand qualitative filter papers Grade No 413 VWR Scientific Westchester Pennsylvania Catalog 28310 026 7 5 cm diameter and 28310 106 12 5 cm diameter NOTICE TO PURCHASER U S Patent No 5 776 689 entitled Protein Recruitment System and covering this two hybrid system is owned by The Regents of the University of California and Baylor College of Medicine Use of th
11. C T4 DNA ligase 4 U ul 140 U 20 C Phosphorylation reagents T4 polynucleotide kinase 5 U l 50 U 20 C Ligase buffer 10x 250 ul 20 C rATP 10 mM 100 ul 20 C Xho digestion reagents Xho 40 U ul 600 U 20 C Xho buffer supplement 250 ul 20 C Column reagents Connecting tubing d 1 8 inch i d 3 16 inch o d and 1 32 inch wall 1 x4cm Room temperature or 4 C Sepharose CL 2B gel filtration medium 10 ml 4 C Column loading dye 17 5 wl 4 C STE buffer 10x 10 ml 20 C Enough reagents are included to generate five vector ligated constructs These reagents are used more than once in the reaction See Preparation of Media and Reagents 4 The Sepharose CL 2B gel filtration medium and the column loading dye are shipped separately at 4 C 2 Cytotrap XR Library Construction Kit ADDITIONAL MATERIALS REQUIRED Certain reagents recommended in this instruction manual are potentially dangerous and present the following hazards chemical DEPC phenol chloroform methylmercury hydroxide and sodium hydroxide radioactive P labeled radioisotope or physical high voltage electrophoresis systems The researcher is advised to take proper precautions and care with these hazards and to follow the safety recommendations from each respective manufacturer Reagents and Solutions Phenol chloroform 1 1 v v and chloroform Note Do not use the low pH phenol from the Stratagene RNA Isolati
12. and vortex 7 Spin the reaction in a microcentrifuge at maximum speed for 2 minutes at room temperature and transfer the upper aqueous layer containing the cDNA to a new tube 8 Precipitate the cDNA by adding the following to the saved aqueous layer 20 ul of 3 M sodium acetate 400 ul of 10096 v v ethanol Vortex the reaction 9 Incubate the precipitation reaction overnight at 20 C 10 In order to orient the direction of precipitate accumulation place a mark on the microcentrifuge tube or point the tube hinge away from the Cytotrap XR Library Construction Kit 2 11 12 13 14 15 16 17 center of the microcentrifuge as an indicator of where the pellet will form Spin in a microcentrifuge at maximum speed for 60 minutes at 4 C Avoid disturbing the pellet and carefully remove and discard the radioactive supernatant in a radioactive waste container Note The conditions of synthesis and precipitation produce a large white pellet The pellet accumulates near the bottom of the microcentrifuge tube and may taper up along the marked side of the tube Gently wash the pellet by adding 500 ul of 7096 v v ethanol to the side of the tube away from the precipitate Do not mix or vortex Spin in a microcentrifuge at maximum speed for 2 minutes at room temperature with the orientation marked as in step 10 Aspirate the ethanol wash and dry the pellet by vacuum centrifugation Resuspend the pel
13. be verified as outlined below prior to performing the CytoTrap system assays 1 Prepare four sets of SD agar plates using the appropriate 10x dropout solutions see Synthetic Minimal Medium in Preparation of Media and Reagents to test the cdc25H yeast strain for the following nutritional requirements tryptophan Trp leucine Leu histidine His and uracil Ura Streak yeast from the 80 C glycerol stock onto each of the four agar dropout plates as outlined in steps 1 and 2 of Establishing an Agar Plate Yeast Streak and incubate the plates at room temperature 22 25 C for 4 6 days 2 Simultaneously streak a sample of the same glycerol stock onto a YPAD agar plate and incubate the plate at room temperature 22 25 C for 4 6 days 3 After the phenotype has been verified growth on the YPAD plate and no growth on any of the four SD agar dropout plates use colonies from the YPAD plate to inoculate medium for the preparation of competent yeast cells see Preparation of cdc25H Yeast Competent Cells Cytotrap XR Library Construction Kit 11 CONTROL PLASMIDS Description P ADHI 2 micron ori LEU2 The CytoTrap system includes two negative control plasmids Figure 4 and three positive control plasmids Figure 5 The pSos Collagenase I pSos Col I control plasmid expresses the Sos protein and amino acids 148 357 of murine 72 kDa type IV collagenase The pMyr Lamin C control plasmid e
14. eese esee esee eese ee neenon aetas tasses ette ette sten seta seen setas etas sense eaae 51 Library Screening eo 53 Cotransformation and Identification of Putative Positive Interactors 53 Verification of Interaction mM 57 Method A Yeast Cotransformation cscsssssseccesecseeeecesecaeseceeeeeceaecaeeeneesecseeeeeeneenaeeas 57 Method B Yeast Mating irent reete eee ee EA NEE E Ee AEE EKO E oe KTS N 59 Appendix I General Comparison of Escherichia coli versus Yeast Host Strains 62 Appendix II RNA Purification and Quantification eee eres tenes eee eene n etna inso ne tnano 63 Appendix III Methylmercury Hydroxide Treatment eee eee eese reete testen enn tnano 64 Appendix IV Alkaline Agarose Gels eee eee eese esee esee testen statuas tatis ense tastes sns tn neto 65 Appendix V Ethidium Bromide Plate Assay Quantitation of DNA scsccssssssssessessseseees 68 Troubleshooting i E M 69 Preparation of Media and Reagents sesessossesessesossossescscosossesossoseesesossossesesossossesosroseesesossoseesesosese 71 References sigs as oses nc detentus diede ate v han quaes v d quu RASEN RENE DUARTE QUE 76 Supplemental References eres eene eee eee ette ette etta etta ette setas teas tease tn s taa taa eaa eset easet ee etes epe eaa 76 Supp 77 CytoTrap XR Library Constructio
15. faster than a sequential transformation strategy and because it limits the number of generations of growth prior to the interaction assay and thus reduces the incidence of cdc25H reversion leading to false positives Cotransformation is especially useful when the bait plasmid is toxic to the yeast cells thereby hindering the preparation of competent cells containing the bait plasmid Toxicity of the bait protein can be determined by comparing growth curves of cdc25H yeast competent cells containing the bait plasmid and cdc25H yeast competent cells containing the pSos Col I plasmid grown in selective media Plasmids may also be transformed singly into yeast competent cells followed by mating of the bait plasmid containing and target plasmid containing yeast strains If you are performing single transformations transform each plasmid into both mating types a and a of cdc25H to facilitate subsequent mating Transformation of Control Plasmids In order to gain familiarity with the protocol and expected results users that are new to the yeast two hybrid system should transform the control plasmids described in Table IV into the cdc25H strain prior to the initial transformation of the bait and target plasmids After the protocols are familiar we recommend including at least one positive and one negative control transformation in parallel with each bait and target plasmid transformation as indicators of yeast growth levels in the presence an
16. heat pulse during transformation Optimal efficiencies are observed when cells are heat pulsed for 30 seconds Heat pulsing for at least 30 seconds is recommended to allow for slight variations in the length of incubation Efficiencies decrease when incubating for 30 seconds or for gt 40 seconds Do not exceed 42 C Preparing the Agar Plates for Color Screening To prepare the plates for blue white color screening add X gal and IPTG to molten LB agar according to the recipe in Preparation of Media and Reagents Alternatively 100 ul of 10 mM IPTG stock prepared in sterile distilled water and 100 wl of 2 X gal stock prepared in dimethylformamide can be spread on the LB agar plates 30 minutes prior to plating the transformations Cytotrap XR Library Construction Kit 33 See Preparation of Media and Reagents TRANSFORMING XL10 GOLD CELLS WITH THE PMYR CDNA LIBRARY Transformation Protocol 10 Thaw the XL10 Gold Kan ultracompetent cells on ice Gently mix the cells by flicking the tube Aliquot 100 ul of the cells into a prechilled 14 ml BD Falcon polypropylene tube Add 4 ul of the XL10 Gold B ME mix provided with the kit to the 100 ul of bacteria Using an alternative source of B ME may reduce transformation efficiency Swirl the contents of the tube gently Incubate the cells on ice for 10 minutes swirling gently every 2 minutes Add 1 ul of the ligation reaction from step 3 of Ligating cDNA into the Pl
17. in cells of opposite mating type TABLE VI Yeast Mating Combinations for Single Plasmid Transformants SD UL 37 C Yeast Transformation SD UL 25 C after patching Mating Mating Type Glucose Galactose Glucose Galactose Type a a pSos MAFB pMyr SB pSos MAFB pMyr Lamin C t i pSos Bait pMyr SB e This mating experiment serves as a positive control This mating experiment serves as a negative control This mating experiment is a control that confirms the integrity of the pSos vector the SB protein expressed from pMyr SB interacts with the Sos protein expressed from pSos Bait to rescue the growth at 37 C when plated on SD galactose UL 2 Spot 2 5 ul of each of the two yeast H 0 suspensions to be mated onto the same position on a YPAD plate Incubate the plate at room temperature 22 25 C for 24 hours 3 Aliquot 25 ul of autoclaved H 0 to wells of sterile 96 well plates Transfer mated cells from each mating patch of the YPAD plate into a separate well 4 Spot 2 5 wl of each of the yeast H 0 suspensions on two SD glucose UL and two SD galactose CUL agar plates Transfer one plate of each type to 37 C Keep the second plate of each type at room temperature 22 25 C Score the growth at 37 C after at least 5 days incubation time The SD galactose UL agar plates that are incubated at 37 C may require up to 7 10 days incubation
18. may cause the microcolonies to fall out of suspension The bottles must be incubated without disturbance or representation of the amplified library may be compromised Tighten the bottle caps and incubate the bottles for 1 hour in an ice water bath 0 C The water level in the ice bath should be even with the media level in the bottle Carefully remove the bottles from the ice bath and gently dry the bottles Loosen the bottle caps and incubate for 40 45 hours at 30 C incubation at 30 C reduces under representation of slower growing clones Pour the contents of the bottles into sterile 250 ml centrifuge bottles and spin at 10 000xg for 20 minutes at room temperature Equilibrate the rotor to room temperature several hours prior to centrifugation Using rotors stored at 4 C will cause the agar to solidify Remove the semi solid agarose supernatant and resuspend the pellets in 25 ml of 2x LB glycerol 12 596 see Preparation of Media and Reagents per 250 ml centrifuge bottle Remove 100 ul for estimation of library titer and further characterization Pipet the remainder into 1 ml aliquots Store at 80 C Perform 6 serial dilutions with 100 ul of the amplified library diluted into 900 ul of LB medium Plate 10 ul of the 102 107 105 and 10 dilutions onto selection plates This amplification should result in approximately a 1000 fold increase in stable transformants 38 Cytotrap XR Library Construction Kit BAIT PLAS
19. ml of PEG Lithium Acetate solution and 530 ul of DMSO to each cell preparation Mix thoroughly but gently by pipetting Aliquot 500 ul of competent cells into one microcentrifuge tube and make additional aliquots of 100 ul in separate microcentrifuge tubes For the transformations outlined in Table IV 10x100 ul aliquots are required Best results are obtained if the aliquots of yeast competent cells are used immediately Do not freeze at 80 C for later use See Preparation of Media and Reagents Cytotrap XR Library Construction Kit 45 Transforming Yeast and Detecting Protein Protein Interactions 1 Prepare the yeast transformation mixtures outlined in Table IV below in microcentrifuge tubes Add plasmid DNA in the combinations listed or singly if the resulting transformants will be mated to separate aliquots of freshly prepared cdc25H yeast competent cells see Preparation of cdc25H Yeast Competent Cells Note Single plasmid transformations should be performed in both mating types to facilitate subsequent mating TABLE IV Transformations for Detecting Protein Protein Interactions Volume of Yeast Amount of Competent Medium for Number Plasmid s Plasmid Cells Plating 1 pSos pMyr 2 ug each 500 ul see step 9 2 pSos MAFB 100 ng 100 ul SD glucose L 3 pMyr SB 100 ng 100 ul SD glucose U 4 pMyr Lamin C 100 ng 100 ul SD glucose U pSos MAFB 5 pMyr MAFB 300 ngeach 100 ul SD gluc
20. pellet in 300 ul of SU buffer Add 1 2 ul of Tris base if the solution turns yellow Vortex to resuspend the protein pellet Heat at 65 C for 3 minutes prior to loading to 35 ul to SDS PAGE Western Analysis Analyze by standard western blot techniques using the mouse monoclonal anti Sos antibody BD Biosciences or an antibody that immunoreacts with the bait protein See Preparation of Media and Reagents 52 Cytotrap XR Library Construction Kit LIBRARY SCREENING An overview of the library screening process is shown in Figure 9 Before each library screening prepare fresh yeast competent cells as described in Preparation of Yeast cdc25H Competent Cells It is necessary to test for temperature sensitive revertants every time competent cells are prepared see Evaluation of Control Plates to Determine Success of Yeast Competent Cell Production Initially the pMyr cDNA library and pSos bait cotransformant colonies are selected at permissive temperature then candidate interactors are identified by transferring the cotransformants to 37 C Putative positives are identified among the candidates by two rounds of testing for galactose dependent growth at 37 C The putative positives are subjected to further analysis to verify the interaction Verification strategies include either cotransformation of naive cdc25H yeast with purified plasmid DNA from the putative positive colony and the bait plasmid or curing the puta
21. pellet with 1 ml of 7096 v v ethanol and centrifuge at 14 000 x g for 5 minutes at room temperature Cytotrap XR Library Construction Kit 57 14 15 16 17 18 19 20 Decant the supernatant and dry the DNA pellet under vacuum Resuspend the DNA pellet in 40 ul of dH O Precipitate the DNA with 4 8 ul of 3 M sodium acetate pH 5 2 and 100 ul of ethanol Repeat steps 11 14 Resuspend the DNA pellet in 20 ul of dH O Transform high efficiency electroporation competent E coli cells and select for pMyr cDNA plasmid by plating on LB chloramphenicol agar plates Identify colonies that contain the pMyr cDNA plasmid by preparing miniprep DNA from isolated colonies from the LB chloramphenicol agar plates and subjecting the DNA to restriction digest analysis Verification of Specificity of Protein Protein Interactions To verify the specificity of the interaction between the bait and target proteins transform yeast and plate on selective media as indicated in Table VII Assay the transformants for the ability to grow at 37 C on SD galactose agar plates 1 Prepare and transform the yeast competent cells as described in Preparation of Yeast cdc25H Competent Cells Cotransform the yeast competent cells with the plasmids outlined in Table VII using 300 ng of each plasmid in each cotransformation reaction Plate each transformation reaction on separate 100 mm SD glucose UL plates Incubate the inverted plat
22. recommended for total RNA isolation This method is rapid yet produces large amounts of high quality undegraded RNA Although AccuScript reverse transcriptase is not inhibited by ribosomal RNA rRNA and transfer RNA tRNA contamination it is advisable to select the poly A fraction The amounts of rRNA and tRNA vastly outnumber amounts of mRNA and will decrease the efficiency of the cDNA synthesis Poly A RNA is selected on oligo dT cellulose columns Some protocols call for the addition of SDS in the purification steps Sodium dodecyl sulfate is a powerful enzyme inhibitor and helps prevent degradation of the RNA by RNases but its presence can also inhibit the enzymes required for cDNA synthesis If the mRNA intended for use with this kit is suspended in an SDS solution the RNA must be phenol extracted and ethanol precipitated Ribonucleases A and T1 are widely used in almost all molecular biology labs and are nearly indestructible Ribonucleases are produced by microbes and have also been found in the oils of the skin Make an effort to use tubes and micropipet tips which have been handled only with gloves Use freshly autoclaved and baked tips and tubes Usually these precautions are sufficient but to be absolutely certain that microcentrifuge tubes and other components intended for use with RNA are not contaminated the components can be treated with DEPC Diethylpyrocarbonate is extremely toxic and should be handled with care Sub
23. scored for galactose dependent growth at 37 C Generating Yeast Plasmid Segregants Curing for Mating 1 Culture individual cdc25H putative positive cotransformant colonies separately in 3 ml of SD glucose U liquid medium for 2 days at room temperature 22 25 C with shaking Obtained in step 16 of Library Screening 2 Spread approximately 300 500 ul of the yeast culture on SD glucose U agar plates Incubate the plates at room temperature 22 25 C for 3 4 days or until colonies appear 3 Using sterile pipette tips transfer 30 individual colonies in an orderly grid fashion to SD glucose U and SD glucose L agar plates Colonies that grow on SD glucose U agar plates but not on SD glucose L plates have lost the pSos plasmid and retained the pMyr cDNA plasmid These colonies can be used for mating with a cdc25H strain a harboring any of the pSos plasmids pSos Col I pSos MAFB and the pSos bait construct Cytotrap XR Library Construction Kit Dy Yeast Mating on Plate Procedure Standard 1 Aliquot 25 ul of sterile H O to the wells of sterile 96 well plates Pick colonies of each strain to be mated and transfer cells from individual colonies into separate wells Strains to be mated include cdc25H o segregants containing only pMyr cDNA plasmids see procedures above for the curing process and cdc25H a transformants containing either pSos Col I p5os MAFB or the pSos bait plasmid The
24. supernatant from each tube 7 Resuspend cells in 0 5 ml of 1 M sorbitol 8 Spread each transformation mixture on agar plates as indicated in Table IV and in steps 9 and 10 below Spread cells by dropping approximately 10 sterile non acid washed glass beads on a plate then add the transformation mixture cover the plate and shake or swirl until the mixture is spread on the surface of the plate Once the plate is dry pour off the glass beads Note It is very important to use glass beads for spreading to achieve even distribution of yeast colonies on the plates see Additional Materials Required 9 For transformation 1 plate 10 ul and 100 ul of the cells on separate 150 mm SD glucose UL agar plates see Preparation of Media and Reagents and incubate these plates at room temperature 22 25 C These platings are used to determine cotransformation efficiency Plate the remainder of transformation reaction 1 on a 150 mm SD glucose UL agar plate Incubate the inverted plate at 37 C observing the plate daily for 4 6 days This plate is used to check for temperature sensitive revertants refer to Evaluation of Control Plates to Determine Success of Yeast Competent Cell Production 10 For transformations 2 11 plate the entire transformation reaction on a 100 mm SD glucose plate either SD glucose U SD glucose L or SD glucose UL according to Table IV Incubate the inverted plates at room temperature 22 25 C until
25. the 80 C glycerol stock onto a fresh plate every week Preparation of a 80 C Yeast Glycerol Stock 1 Ina sterile 50 ml conical tube inoculate 10 ml of YPAD broth with one colony grown for a minimal number of generations from a YPAD 10 Cytotrap XR Library Construction Kit plate Grow the cells to late log phase ODgo9 0 8 1 0 at room temperature 22 25 C 2 Add 4 5 ml of a sterile solution of 50 glycerol in liquid YPAD prepared as 5 ml of glycerol 5 ml of YPAD broth to the yeast culture from step 1 Mix well 3 Aliquot the glycerol containing cell suspension into sterile centrifuge tubes 1 ml tube This preparation may be stored at 80 C for more than 2 years 4 Verify the temperature sensitive growth phenotype of the new yeast stock to confirm that the strain has not reverted during growth Streak a sample of the new glycerol stock on two YPAD agar plates Incubate one plate at room temperature 22 25 C and the second plate at 37 C Observe both plates daily for 4 days no growth should be observed on the plate incubated at 37 C Host Strains and Genotypes Host strain Genotype cdc25H Yeast MATa ura3 52 his3 200 ade2 101 lys2 801 trp1 901 Strain a leu2 3 112 cdc25 2 Gal cdc25H Yeast MATa ura3 52 his3 200 ade2 101 lys2 801 trp1 901 Strain a leu2 3 112 cdc25 2 Galt Verification of Yeast Host Strain Marker Phenotype The phenotype of the yeast host strain should
26. the vector DNA is the same as the concentration of the insert DNA 0 1 ug ul 8 Calculate the amount of insert required for the ligation reaction see equation below The ideal molar ratio of insert to vector DNA is variable however a reasonable starting point is 1 1 insert to vector molar ratio measured in available picomole ends This is calculated as follows 2 x 10 Picomole ends microgram of DNA number of base pairs x 660 Cytotrap XR Library Construction Kit 39 9 Ligate the prepared vector and insert DNA fragments according to the protocol in the table below which includes three control ligations Incubate the ligation reaction mixtures overnight at 12 C Suggested Ligation Reactions Ligation Reaction Experimental Control Components Prepared vector 0 1 ug ul Prepared insert 0 1 ug ul 10 mM rATP pH 7 0 10x ligase buffer T4 DNA ligase 4 U l Double distilled water to 10 ul Experimental samples 1 and 2 vary the insert to vector ratio a c Control sample 3 tests the effectiveness of vector digestion and CIAP treatment n Control sample 4 tests for residual uncut vector in the vector preparation a Control sample 5 tests to ensure the insert alone is not contaminated with the vector DNA 8 See Preparation of Media and Reagents 10 Transform each of the ligation reaction mixtures 1 5 above into E coli competent cells Verifying Bait Inse
27. to vector 2 5 ul of 10x ligase buffer 2 5 ul of 10 mM rATP pH 7 5 5 0 ul of the pMyr XR vector 0 1 ug ul X ul of distilled water for a final volume of 22 5 ul Then add 2 5 ul of TA DNA ligase 4 U ul Flick the tube gently to mix then spin down briefly Incubate the reaction tubes overnight at 12 C Transformation Transform 100 ul of XL10 Gold Kan ultracompetent cells individually with 1 3 ul of the ligation reaction see Transformation Protocol The highest number of transformants per nanogram of cDNA is obtained when using 1 ul of ligation reaction per 100 ul of competent cells Pool the individual transformation reactions after the one hour incubation step 10 of Transformation Protocol Note This pool is the primary library Store the primary library at 4 C if amplifying within 1 2 days see Amplifying the pMyr cDNA Library Plate 1 ul and 10 ul of the pooled transformations onto selection plates to determine the total number of primary transformants After the number of cfu ul is determined plate the rest of the pooled transformants on 15 cm LB chloramphenicol plates Each plate should contain approximately 20 000 30 000 colonies Incubate overnight at 37 C Add 6 ml LB medium to each plate and gently scrape the bacteria with a spreader to form a dense suspension 36 Cytotrap XR Library Construction Kit 7 Wash each plate with additional 2 ml LB medium to recover residual bacteria 8 Pool bacte
28. transformation efficiency Approximately 1 x 1042 x 104 colonies should form on each plate To calculate the cotransformation efficiency use the following equation Number of cfu x Total suspension volume 500 ul Volume of transformation plated ul x Amount of DNA used 2ug cfu ug DNA Transformation efficiency 14 After 6 days evaluate the pSos vector and pMyr cDNA control transformation replicas on SD galactose CUL The number of colonies arising from the pSos vector and pMyr cDNA transformation growing at 37 C provides an estimate of the numbers of false positive clones from the cDNA library and of temperature sensitive revertants 15 Also after 6 days pick colonies interactor candidates from the experimental library screen transformation replicates on galactose incubated at 37 C In order to repress GAL1 promoter driven expression from the pMyr library prior to interaction tests patch cells from the interactor candidate colonies onto an SD glucose UL agar plate candidate patch plate and incubate the plate at 22 25 C for 48 hours Return the original galactose transformation replica plates to 37 C after picking colonies since some additional colonies may appear much later 10 days Cytotrap XR Library Construction Kit 55 16 17 After the 48 hour incubation see step 15 patch cells from the SD glucose UL candidate patch plates onto two fresh SD glucose UL plates and one SD galactose UL plat
29. 0 pl of the XR LacZ test insert transformation on LB chloramphenicol agar plates 3 Incubate the plates overnight at 37 C Note Greater than 30 colonies should be observed from the 1 yil plating of the test insert transformation 4 Pick 50 colonies transfer them to an LB chloramphenicol plate with X gal and IPTG and incubate the cells at 37 C Blue colonies contain the test insert Count the number of chloramphenicol resistant colonies on the 1 1 plate from step 1 above and multiply that number by 1000 Example 200 colonies 1 ul x 1000 ul 2 0 x 10 total cfu Count the number of chloramphenicol resistant colonies on the 10 1u plate from step 1 above and multiply that number by 100 Example 2000 colonies 10 ul x 100 ul 2 0 x 10 total cfu See Preparation of Media and Reagents Cytotrap XR Library Construction Kit 35 Scaling Up the Ligations and Transformations Perform individual ligations according to the ligation protocol to reach the desired primary target library size The number of ligations necessary may vary with each insert and should be based upon efficiencies realized with each pilot reaction The ligation reaction may be scaled up to 25 pl using the following Protocol for Scaling Up Ligation Reactions Protocol for Scaling Up Ligation Reactions Ligation 1 3 4 To scale up the ligation reaction add the following components X ul of resuspended cDNA Use 2 1 molar ratio of insert
30. 10 Gold Cells with the pMyr cDNA Library sccscssscssscssccescssscsessseees 34 Transformation PFOUOCOL ciis eestin pat eoi pec tei pre treat be EES ENK ETS Eoaea EESE N 34 Determining the Number of Transformants eese ener 35 Scaling Up the Ligations and Transformations sesssesecseeceesceeeeeceeecesecaeeeneeseeneeeeees 36 Verifying the Insert Percentage and Size eese 37 Amplifying the pMyr cDNA Library eeeeeseeeeeeeeeeeene entente nennen nennen 37 Bait Plasmid Constr cti D 5253 0 scssdacentetewaescsbascbud aste pursue d nadstet ab dpa elvai dia ENTE 39 Vector and Insert Preparation Ligation and Transformation eee 39 Verifying Bait Insert Cloning and Expression eese 40 Verification of Bait Plasmid Suitability for CytoTrap Interaction Assays 40 Yeast Eransformatl l e eacuscu vecta aui matins sini seni io dau atlas tad oedtivio adii pila RNV esii 41 Cotransformation of Bait and Target Plasmids seen 41 Transformation of Control Plasmids eese nnne 41 Preparation of cdc25H Yeast Competent Cells eese 43 Transforming Yeast and Detecting Protein Protein Interactions esses 46 Mating of Single Plasmid Yeast Transformants eese 50 Verifying Bait Protein Expression 4
31. 5 L Leucine L 8000 L Lysine HCI L 5626 L Methionine 200 M 9625 L Phenylalanine 500 P2126 L Threonine T 8625 L Tryptophan T 0254 L Tyrosine T 3754 L Uracil 200 U 0750 L Glutamic acid G 1251 L Aspartic acid A 9256 L Serine 400 S 4500 a The omission of Leu from the 10x dropout solution selects for the pSos plasmid or any other vector that expresses the LEU2 gene The omission of Ura from the 10x dropout solution selects for the pMyr plasmid or any other vector that expresses the URA3 gene The omission of both Leu and Ura from the 10x dropout solution selects for both plasmids Add these amino acids only after autoclaving the 10x dropout solution Cytotrap XR Library Construction Kit 75 REFERENCES Petitjean A Hilger F and Tatchell K 1990 Genetics 124 4 797 806 Chardin P Camonis J H Gale N W van Aelst L Schlessinger J et al 1993 Science 260 5112 1338 43 Reponen P Sahlberg C Huhtala P Hurskainen T Thesleff L et al 1992 J Biol Chem 267 11 7856 62 Bartel P L Chien C T Sternglanz R and Fields S 1993 In Cellular Interactions in Development A Practical Approach pp 153 179 Oxford Univ Press Oxford England Kataoka K Fujiwara K T Noda M and Nishizawa M 1994 Mol Cell Biol 14 11 7581 91 Chomczynski P and Sacchi N 1987 Anal Biochem 162 1 156 9 Kreiegler M 1990 In Gene Transfer and Expression A Laboratory Manua
32. 6 00800 7000 7000 31 0 20 312 5700 00800 7001 7001 0800 023 0448 00800 7400 7400 0800 563 080 0800 563 082 0800 563 081 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 917 3282 0800 917 3283 0800 917 3281 All Other Countries Please contact your local distributor A complete list of distributors is available at www stratagene com CytoTrap XR Library Construction Kit Contents Materials Provided i cciscccscasscasccossacesacosdesssasvetecvosdsuccossicavactidevusestesiesssverteevsccsacestacsesdestesecsbdvecvessvasenses 1 Ernie a 1 Additional Materials Required 4 eee eee e eee ente eren seen ette sten sense tones ette ette ette stent ese etos eaa 3 Reagents and Solutions nce eee eee e eo e SERE EHE RE resto EU Eee e eden 3 Sequencing Primers and Sequences scsscseceecceseeseeeecsecseesecesecsceeceeacesecsaeeaeeeeaecaeeeneeaes 4 EqUIDmeHlt s teetereeo rri tro rete ete eter eo a eco re De ep rese Ee eee area esee Io Dre Eee etae ep ig 4 ENERO GUCII ON em T E E E E 5 6 Sacer 7 PMYE VeGIOL uode E seo tare etta ge et ro eh Pop ae ag sa a eee DP E su aa ee UR e er eo paa 9 Preparation of Yeast Host Strain e eeeeeeee esee eese eee ee sets tn seta stt tosta stato seta sesta sense ta snsen 10 Estab
33. 7 ml of sterile deionized H O De gas this mixture under vacuum for several minutes Add the following reagents 25 ul of TEMED 250 ul of 10 ammonium persulfate Cytotrap XR Library Construction Kit 73 NZY Broth per Liter 10 g of NZ amine casein hydrolysate 5 g of yeast extract 5 g of NaCl Add deionized H O to a final volume of 1 liter Adjust to pH 7 5 using NaOH Autoclave Add the following filer sterilized supplements prior to use 12 5 ml of 1 M MgCl 12 5 ml of 1 M MgSO 20 ml of 2096 w v glucose or 10 ml of 2 M glucose PEG Lithium Acetate Solution 10 mM Tris HCl pH 8 0 1 mM EDTA pH 8 0 100 mM lithium acetate pH 7 5 40 w v PEG 3350 Autoclave 10x STE Buffer 1M NaCl 200 mM Tris HCl pH 7 5 100 mM EDTA Salmon Sperm DNA Boil 400 ul of 20 mg ml sheared salmon sperm DNA for 10 minutes Add 600 ul of LiSORB to the salmon sperm DNA and mix by pipetting Cool the salmon sperm DNA mixture to room temperature not below room temperature or the mixture will gel Sonicate or randomly shear the salmon sperm DNA For higher efficiency phenol chloroform extract and resuspend in TE buffer at a concentration of 20 mg ml Store the aliquots at 20 C Before use boil the salmon sperm DNA for 5 minutes 2x LB Glycerol 12 5 per 100 ml 2 g NaCl 2 g tryptone 1 g yeast extract Add deionized H O to a final volume of 50 ml Adjust to pH 7 0 with 5 N NaOH Autoclave Add 50 ml aut
34. CTC 5 o GENTES sa nnnnaaaaaactccac 3 EcoR adapters T4 DNA ligase EcoR CHa CH3 CH3 CH3 CH3 Xho L EcoR Adapter addition 3 G TTTTTTTTTTTTGAGCTC CTTAA 5 5 AATTC ONEEEBOT ENEEBEB GAAAAAAAAAACTCOAG G Xho restriction enzyme EcoR CH4 CHa CH3 CH3 CH3 Xho Xho I digestion 3 G TTTTTTTTTTTTGAGCT 5 5 aatto ANID ooo Completed unidirectional cDNA FIGURE 6 cDNA synthesis flow chart Cytotrap XR Library Construction Kit 15 cDNA Libraries Complementary DNA inserts to be ligated into the pMyr vector are prepared from mRNA The cDNA Synthesis Kit provides the reagents required to convert mRNA to cDNA inserts prior to unidirectional insertion into the pMyr XR vector The protocols for preparing cDNA inserts are found in cDNA Insert Preparation and Ligation cDNA Insert Preparation and Ligation Background for Preparation of cDNA Libraries Complementary DNA libraries represent the information encoded in the mRNA of a particular tissue or organism RNA molecules are exceptionally labile and difficult to amplify in their natural form For this reason the information encoded by the RNA is converted into a stable DNA duplex cDNA and then is inserted into the pMyr XR vector Once the information is available in the form of a cDNA library individual processed segments of the original genetic information can be isolated and examined with relative ease Therefore cDNA library construction provides a met
35. Column 1 Load the drip column with a uniform suspension of Sepharose CL 2B gel filtration medium as outlined in the following steps a Immediately prior to loading the drip column gently mix the Sepharose CL 2B gel filtration medium by inversion until the resin is uniformly suspended Place the column in the ring stand Fill a glass Pasteur pipet with 2 ml of 1x STE buffer Insert the pipet as far into the drip column as possible and fill the column with the buffer Notes If the 1x STE buffer flows too quickly through the column stem the flow by affixing a yellow pipet tip to the end of the column Make sure to remove the pipet tip prior to loading the column with the Sepharose CL 2B gel filtration medium If bubbles or pockets of air become trapped in the STE buffer while filling the column remove the trapped air prior to packing the column with the resin To remove the bubbles or air re insert the Pasteur pipet into the top of the column and gently pipet the STE buffer in and out of the pipet until the trapped air escapes through the top of the column Immediately add a uniform suspension of Sepharose CL 2B gel filtration medium to the column with a Pasteur pipet by inserting the pipet as far into the column as possible As the resin settles continue adding the Sepharose CL 2B gel filtration medium Stop adding the resin when the surface of the packed bed is inch below the lip of the pipet The lip of the pipet is def
36. CytoTrap XR Library Construction Kit INSTRUCTION MANUAL Catalog 200444 BN 200444 12 Revision A 01 For In Vitro Use Only 200444 12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product No other warranties of any kind express or implied including without limitation implied warranties of merchantability or fitness for a particular purpose are provided by Agilent Agilent shall have no liability for any direct indirect consequential or incidental damages arising out of the use the results of use or the inability to use this product ORDERING INFORMATION AND TECHNICAL SERVICES United States and Canada Agilent Technologies Stratagene Products Division 11011 North Torrey Pines Road La Jolla CA 92037 Telephone Order Toll Free Technical Services Internet World Wide Web 858 373 6300 800 424 5444 800 894 1304 techservices agilent com www stratagene com Europe Location Telephone Fax Technical Services Austria 0800 292 499 0800 292 496 0800 292 498 Belgium 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 15775 0800 15740 0800 15720 France 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 919 288 0800 919 287 0800 919 289 Germany 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 182 8232 0800 182 8231 0800 182 8234 Netherlands Switzerland United Kingdom 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 023 044
37. F to a final concentration of 80 ug ml and IPTG stock made in sterile distilled water to a final concentration of 20 mM or Spread 100 ul of 10 mM IPTG and 100 ul of 296 X gal on LB chloramphenicol agar plates 30 minutes prior to plating the transformations LB Ampicillin Agar per Liter 1 liter of LB agar autoclaved Cool to 55 C Add 10 ml of 10 mg ml filter sterilized ampicillin Pour into petri dishes 725 ml 100 mm plate 1 4 M p ME yeast competent cells Dilute stock B mercaptoethanol 1 10 with sterile dH O just prior to use LB Chloramphenicol Agar per Liter Prepare 1 liter of LB agar Autoclave Cool to 55 C Add 3 ml of 10 mg ml filter sterilized chloramphenicol Pour into petri dishes 25 ml 100 mm plate LiSORB per Liter 100 mM lithium acetate 10 mM Tris HCl pH 8 0 1mM EDTA 1M sorbitol Add dH5O to a volume of 1 liter Verify that the pH is 8 0 Autoclave Store at room temperature NaOH s ME Buffer 1 85 M NaOH 7 5 p Mercaptoethanol Nondenaturing Acrylamide Gel 5 Mix the following in a vacuum flask 5 ml of 10x TBE buffer TE Buffer 8 33 ml of a 29 1 acrylamide bis 10 mM Tris HCl pH 7 5 acrylamide solution 1 mM EDTA 72 Cytotrap XR Library Construction Kit Column Loading Dye 50 v v glycerol 10 v v 10x STE buffer 40 w v saturated BPB for saturated BPB see footnote in recipe for Alkaline Agarose 2x Loading Buffer above 36 6
38. MID CONSTRUCTION Vector and Insert Preparation Ligation and Transformation DNA encoding the bait protein is prepared for insertion into the pSos vector either by restriction digestion or PCR amplification DNA encoding the bait protein must be inserted so that the bait protein is expressed in the same reading frame as the hSos protein In the MCS of the pSos vector the Hind III BamH I Nco I Srf I Aat II Sal I BssH II Mlu I Sac I and Not I sites are unique however the Pac I Sac II Xba I and Sma I sites are not Dephosphorylate the digested pSos vector with CIAP prior to ligation with the insert DNA If more than one restriction enzyme is used the background can be reduced further by selective precipitation using ammonium acetate eliminating the small fragment that appears between the two restriction enzyme sites 1 Digest5 ug of the vector DNA in a final volume of 50 jl 2 Extract with an equal volume of phenol chloroform until a clear interface is obtained 3 Repeat the extracion once with an equal volume of chloroform only 4 Add an equal volume of 4 M ammonium acetate to the aqueous phase 5 Add 2 5 volumes of 10096 v v ethanol at room temperature Immediately spin in a microcentrifuge at room temperature to precipitate the vector DNA 6 Wash the pellet once with 70 v v ethanol 7 Resuspend the pellet in a volume of TE buffer see Preparation of Media and Reagents such that the concentration of
39. UL agar plates that are incubated at 37 C may require up to 7 10 days incubation time for yeast colonies to appear The expected results are outlined in Table V TABLE V Expected Results for Yeast Transformations SD Glucose UL SD UL 37 C after spotting Number Plasmid s Transformed U or L as Glucose Galactose appropriate 25 C p5os pMyr N A N A 2 pSos MAFB t N A N A 3 pMyr SB t N A N A 4 pMyr Lamin C N A N A 9 pSos MAFB pMyr MAFB B 6 pSos MAFB pMyr Lamin C 7 pSos Col pMyr MAFB 8 psos MAFB pMyr SB 9 pSos Bait N A N A 10 pSos Bait pMyr Lamin C 11 p5os Bait pMyr SB Only the cotransformations are spotted and grown at 37 C 5 See Preparation of Media and Reagents Cytotrap XR Library Construction Kit 49 Mating of Single Plasmid Yeast Transformants Yeast Mating on Plate Procedure Standard 1 Aliquot 25 ul of autoclaved H5O to wells of sterile 96 well plates Pick one colony of each transformant to be mated into a separate well See Table VI below for the mating combinations and expected results Note Table VI illustrates one mating experiment between transformants in mating type a 1 column and transformants in mating type 2 column It is not necessary that the mating take place exactly as outlined as long as the two plasmids to be tested for interaction are harbored
40. a strain transformants of the pSos plasmids were prepared previously and plated on SD glucose L see introductory section under the heading Library Screening 2 Spot 2 5 ul of the yeast H O suspension of both mating partners onto the same position on a YPAD plate Incubate the plates at room temperature 22 25 C for approximately 24 hours 3 Aliquot 25 ul of autoclaved H 0 to wells of sterile 96 well plates Transfer mated cells from each mating patch of the YPAD plate into a separate well 4 Spot 2 5 wl of each of the yeast H 0 suspensions on two SD glucose UL and two SD galactose CUL agar plates Transfer one plate of each type to 37 C Keep the second plate of each type at room temperature 22 25 C Score the growth at 37 C after at least 5 days incubation time The SD galactose UL agar plates that are incubated at 37 C may require up to 7 10 days incubation time for yeast colonies to appear The expected results are shown in Table VIII Yeast Mating in Solution Procedure Microtiter Plate Version 1 Aliquot 200 ul of YPAD medium to wells of sterile 96 well plates Pick a cdc25H a segregant containing only the pMyr cDNA plasmid see procedures above for the curing process and a colony of the appropriate cdc25H a transformant containing either pSos Col I pSos MAFB or pSos bait plasmid into the same well Repeat this process for each of the combinations to be mated see Table VIIT 2 Place the p
41. absence of an interaction partner The pSos bait plasmid Cytotrap XR Library Construction Kit containing the gene of interest must be cotransformed into the yeast host with either pMyr or pMyr Lamin C to establish that the bait protein does not interact with the myristlyation signal provided by these negative control plasmids Perform the co transformation according to the protocols outlined in Yeast Transformation below After cotransformation incubate the plates initially at room temperature 22 25 C to allow colony formation Patch colonies arising at room temperature onto fresh plates containing galactose and assay for growth at 37 C If the bait plasmid cotransformed with the pMyr empty vector or pMyr Lamin C can induce cdc25H yeast growth at 37 C then the bait plasmid is unsuitable for detecting protein protein interactions in the CytoTrap system Induction of growth of the yeast host at 37 C by the bait plasmid may also occur if the bait protein contains sequences that target them to the membrane This problem may be resolved by deleting portions of the bait protein however deletions may also eliminate portions of the protein required for interaction with the target protein YEAST TRANSFORMATION Cotransformation of Bait and Target Plasmids We recommend introducing the bait and target plasmids into the cdc25H yeast strain by cotransformation This strategy is recommended because it allows results to be generated 5 days
42. action in a microcentrifuge for 2 seconds Cool the reaction at room temperature for 5 minutes 2 Phosphorylate the adapter ends by adding the following components 1 ul of 10x ligase buffer 2 ul of 10 mM rATP 5 pl of sterile water 2 ul of T4 polynucleotide kinase 5 0 U ul 3 Incubate the reaction for 30 minutes at 37 C 4 Heat inactivate the kinase for 30 minutes at 70 C 5 Spin down the condensation in a microcentrifuge for 2 seconds and allow the reaction to equilibrate to room temperature for 5 minutes Digesting with Xho 1 Addthe following components to the reaction 28 ul of Xho I buffer supplement 3 ul of Xho I 40 U ul 2 Incubate the reaction for 1 5 hours at 37 C 3 Add 5 ul of 10x STE buffer and 125 ul of 100 v v ethanol to the microcentrifuge tube 4 Precipitate the reaction overnight at 20 C 5 Following precipitation spin the reaction in a microcentrifuge at maximum speed for 60 minutes at 4 C 6 Discard the supernatant dry the pellet completely and resuspend the pellet in 14 ul of 1x STE buffer 7 Add 3 5 ul of the column loading dye to each sample The sample is now ready to be run through a drip column containing Sepharose CL 2B gel filtration medium see Size Fractionating 24 Cytotrap XR Library Construction Kit Size Fractionating Before attempting the experimental protocols outlined within this section please read this section in its entirety in order to bec
43. action with 25 ul 5 ug of test RNA and 11 ul of DEPC treated water 4 In an RNase free microcentrifuge tube add the following reagents in order 5 ul of 10x first strand buffer 3 ul of first strand methyl nucleotide mixture 2 ul of linker primer 1 4 ug ul X wl of DEPC treated water 1 ul of RNase Block Ribonuclease Inhibitor 40 U ul 5 Mix the reaction and then add X ul of poly A RNA 5 ug Mix gently 6 Allow the primer to anneal to the template for 10 minutes at room temperature During the incubation aliquot 0 5 ul of the a P dNTP 800 Ci mmol into a separate tube for the control 7 Add 3 pl of AccuScript RT to the first strand synthesis reaction The final volume of the first strand synthesis reaction should now be 50 ul 8 Mix the sample gently and spin down the contents in a microcentrifuge 9 Transfer 5 ul of the first strand synthesis reaction to the separate tube containing the 0 5 ul of the ao P dNTP 800 Ci mmol This radioactive sample is the first strand synthesis control reaction 10 Incubate the first strand synthesis reactions including the control reaction at 42 C for 1 hour Cytotrap XR Library Construction Kit 19 11 12 Prepare a 16 C water bath for second strand synthesis If a water bath with a cooling unit is not available use a large Styrofoam container with a lid Fill the container three quarters full with water and adjust the temperature to 16 C with ice Cover th
44. al to avoid a vacuum between the teeth and the well Vacuum can be detected when the well distorts from its normal square shape When a vacuum occurs push the comb to separate the glass plates and break the vacuum After the samples have been run and the glass plates are ready to be opened slide the unfrosted glass plate off of the alkaline agarose gel instead of prying the plate away from the gel Pat the gel dry several times using several pieces of Whatman 3MM paper Note To prevent radioactive contamination of film cassettes seal the wet gels in airtight hybridization bags Be careful not to trap any air in the hybridization bag which could lift the film away from the gel and cause blurring Conventional Submerged Gels Protocol These gels will require drying either by blotting or through the use of a gel dryer Caution Even when multiple layers of absorbent paper are placed under the gel free nucleotides can easily contaminate the drying apparatus These gels should be poured as thin as possible and should be dried without heat if time permits and should never be dried above 40 C The following formula makes 80 ml of 196 w v alkaline agarose for electrophoresis of cDNAs in the 1 3 kb size range Melt 0 8 g of agarose in 72 ml of water Allow the agarose to cool to 55 C During this time assemble the gel apparatus Add 8 ml of 10x alkaline buffer to the cooled agarose swirl to mix and pour the agarose immediately If bu
45. asmid Vector to the cells and swirl gently For the control ligation add 1 ul to 100 pl cells Note As a transformation control add 1 ul of pUC18 plasmid diluted 1 10 in high quality water to another 100 1 aliquot of the cells and swirl gently Incubate the tubes on ice for 30 minutes Preheat NZY broth see Preparation of Media and Reagents in a 42 C water bath for use in step 10 Heat pulse the tubes in a 42 C water bath for 30 seconds The duration and temperature of the heat pulse is critical for obtaining the highest efficiencies Do not exceed 42 C Incubate the tubes on ice for 2 minutes Add 0 9 ml of preheated 42 C NZY broth to each tube and incubate the tubes at 37 C for 1 hour with shaking at 225 250 rpm Notes For quantities of pilot ligations to plate see Determining the Number of Transformants The cells may be concentrated by centrifuging at 200 x g for 3 5 minutes if desired Resuspended the pellet in 200 ul of NZY broth and plate When transforming the control pUC18 DNA plate 5 ul of the transformation mixture in a 200 ul pool of NZY broth on LB ampicillin agar plates 250 colonies may be expected from 34 Cytotrap XR Library Construction Kit each 5 ul of the pUC18 control transformation to yield 25x 109cfu ug Determining the Number of Transformants Plating 1 Plate 1 wl and 10 ul of each 1 ml pilot transformation onto LB chloramphenicol agar plates 2 Plate 1 ul and 1
46. at temperatures above 25 C It is critical to establish a frozen glycerol stock of cdc25H cells then to minimize the number of generations between retrieval from the freezer stock and final two hybrid interaction assays The yeast host strain has been sent as a glycerol stock Refer to the table below for the appropriate media for completing procedures in this section Agar plate for yeast Medium for yeast Host strain streak glycerol stock cdc25H a or a YPAD Agar YPAD Broth See Preparation of Media and Reagents Establishing an Agar Plate Yeast Streak Place the provided yeast host strain glycerol stock vials at 80 C immediately Prepare agar plate yeast streaks from the provided glycerol stocks to use as working stocks of the cdc25H strains Notes The host yeast strains should be stored immediately at 80 C Avoid repeated thawing of the yeast strains in order to maintain extended viability It is critical to grow the cdc25H yeast at room temperature 22 25 C Higher temperatures induce mutational revertants 1 Obtain cells from the glycerol stock by scraping off splinters of solid ice with a sterile wire loop or sterile inoculating stick 2 Streak the splinters onto a YPAD agar plate 3 Incubate the plate at room temperature 22 25 C until colonies appear 4 days 4 Seal the plate with Parafilm laboratory film and store the plate at 4 C for up to 1 week 5 Restreak the yeast culture from
47. bation temperatures above 16 C Add second strand synthesis reaction components to the first strand reaction mix on ice and then transfer the reaction mixture directly to 16 C for incubation After incubation place the samples on ice immediately Ensure that sufficient mRNA is present Optical density readings may be obscured by contaminating rRNA or DNA and may give a false indication of the amount of mRNA used in the synthesis Repeat the mRNA preparation Some sources of RNA may have secondary structure e g tumors some plants etc The RNA may have to be treated with methylmercury hydroxide to relax the secondary structure see Appendix Ill Methyl mercury Hydroxide Treatment Ensure the correct amount of DNA polymerase is being used Use a calibrated pipet to measure the enzyme Do not submerge the pipet tip completely in the enzyme solution as additional enzyme will adhere to the outside of the pipet tip Low counts in the drip column fractions The number of counts per second per fraction may vary from O to 250 cps and yield primary libraries of gt 1 x 106 pfu Most of the counts remaining in the drip column are from unincorporated a 32P dNTP Verify the quantity of cDNA on the EtBr plate Poor ligation Do not use excess ligase as this introduces an inhibitory amount of glycerol into the reaction Do not submerge the pipet tip completely in the enzyme solution as additional enzyme will adhere to the outsi
48. colonies are visible 4 6 days Evaluation of Control Plates to Determine Success of Yeast Competent Cell Production 1 Evaluate the quality of the cdc25H competent cell preparation by determining the frequency of temperature sensitive revertants see steps 2 and 3 and the transformation efficiency see step 4 for the preparation 2 Two control plates are used to test for temperature sensitive revertants The first control plate from Preparation of cdc25H Yeast Competent Cells step 6 contains a 75 ul aliquot of the yeast culture used to prepare competent cells If after incubation at 37 C for 4 6 days this plate contains more than 30 colonies the culture contained a high number of temperature sensitive revertants or a contaminant which is not cdc25H The observation of more than 30 colonies on this plate invalidates any transformations performed using the corresponding competent cell preparation Cytotrap XR Library Construction Kit 47 3 The second reversion control plate from transformation 1 in Table IV contains cells cotransformed with pSos and pMyr After incubation of this plate 37 C for 4 6 days no colonies should appear Colonies present on this plate indicate that the cells used for the transformation contained temperature sensitive revertants or were not cdc25H This observation invalidates the transformations performed to detect protein protein interactions with the corresponding competent cell preparation
49. d absence of interacting proteins For the control plasmid transformation follow the procedures outlined in Preparation of cdc25H Yeast Competent Cytotrap XR Library Construction Kit 4 Cells and Transforming Yeast and Detecting Protein Protein Interactions using the control plasmid combinations outlined in Table IV 42 Cytotrap XR Library Construction Kit Preparation of cdc25H Yeast Competent Cells Figure 8 shows an overview of the stages for preparing yeast competent cells This protocol outlines a strategy for verifying that the cell culture used to prepare competent cells does not contain revertants of the cdc25H temperature sensitive phenotype If revertants have arisen during the preparation of competent cells the competent cell preparation is not suitable for CytoTrap two hybrid experiments Notes A number of specialized media and reagents are required for the protocols in this and subsequent sections of the procedure Consult the Preparation of Media and Reagents section for detailed recipes and instructions for media and reagent preparation This protocol yields 6 8 ml of yeast competent cells which is enough for the initial transformations see Table IV For transforming a pMyr cDNA library 10 5 ml of yeast competent cells is required Instead of scaling up the protocol perform the protocol below in two parallel flasks tubes producing 2 x 6 8 ml of yeast competent cells 1 Prepare a fresh plate of cdc25H a
50. de of the pipet tip Cytotrap XR Library Construction Kit 69 Two Hybrid Vector System Screening Observation More than 30 colonies appear on non transformed plates when incubated at 37 C gt 4 days The bait protein is not detected in Western blot analysis Transformation with the bait plasmid alone results in colonies at 37 C The control plasmids do not give the expected results Cotransformants of pSos MAFB and pMyr MAFB do not grow at 37 C Cotransformants of pSos Col and pMyr Lamin C grow at 37 C Transformants show no galactose dependent growth at 37 C Suggestion The culture contains a high number of temperature sensitive revertants or a yeast strain which is not cdc25H Discard the culture Ensure the insert DNA is in the same reading frame as the Sos sequence The insert DNA is expressed at levels too low to be detectable with the antibody used A low level of bait protein may be adequate in the two hybrid assay If the nucleotide sequence encoding the bait protein is correct continue with the two hybrid screening If the antibody does not have a sufficiently high affinity for the bait protein the bait protein may be expressed but may not be detectable If the nucleotide sequence encoding the bait protein is correct continue with the two hybrid screening The Sos bait fusion protein alone can localize to the membrane and activate the Ras signaling pathway Subclone portions of the ba
51. diately before use Vortex the buffers vigorously until no precipitate is visible Minute amounts of SDS or lithium in the RNA will inhibit the first strand synthesis reaction Do not use these in the RNA preparations Multiple phenol chloroform extractions will sometimes remove the inhibitors Ensure that sufficient mRNA is present Optical density readings may be obscured by contaminating rRNA or DNA and may give a false indication of the amount of mRNA used in the synthesis Repeat the mRNA preparation Ensure that the a P dNTP is not contaminated or degraded causing poor label incorporation into cDNA and falsely indicating poor cDNA synthesis Protect the a P dNTP from heat and leave it at room temperature for the minimum time required Interpret the gel results correctly Control RNA will show distinctly different intensity between the first and second strand This is due to the relative amounts of a P to the amount of NTP in the first or second strand reaction Normally the second strand will have only 1 10 to 1 20 the intensity of the first strand band Always mix and spin the enzymes in a microcentrifuge immediately before use Vortex the buffers vigorously No first strand synthesis See the previous suggestions for Poor first strand synthesis No first strand synthesis but good second strand synthesis Ensure that there is no DNA contamination in the RNA preparation Hairpinning Do not allow incu
52. e As a primary test to identify interactors among the candidates incubate one SD glucose CUL and the SD galactose UL plate at 37 C for approximately 48 hours Keep the other SD glucose UL agar plate at room temperature 22 25 C as a re patching source plate After the 48 hour incubation evaluate the primary interaction test plates see step 16 identifying the patches growing at 37 C on SD galactose UL plates but not on SD glucose UL plates Perform a secondary interaction test by re patching the interactor candidates from the re patching source plate kept at 22 25 C see step 16 onto another set of one SD glucose UL and one SD galactose CUL agar plate and incubate both plates at 37 C for 48 hours The candidates producing patches that grow on SD galactose UL plates but not on SD glucose UL plates at 37 C in both the primary and secondary interaction tests should be considered putative positive clones and analyzed further see Verification of Interaction 56 Cytotrap XR Library Construction Kit VERIFICATION OF INTERACTION Verify the interaction between the pSos bait fusion protein and the putative positive interacting target proteins using one of the following two methods Method A involves isolating pMyr library plasmids from putative positive clones and using them to retransform cdc25H cells with either the original bait or with irrelevant baits Method B uses yeast mating as an alternati
53. e container with a lid After 1 hour remove the first strand synthesis reactions from the 42 C water bath Place the nonradioactive first strand synthesis reaction on ice Store the radioactive first strand synthesis control reaction at 20 C until ready to analyze by alkaline agarose gel electrophoresis see Appendix IV Alkaline Agarose Gels The radioactive first strand reaction will be gel analyzed alongside a radioactive sample of the second strand reaction after the second strand reaction has been blunted and resuspended in the EcoR I adapters see step 17 in Blunting the cDNA Termini Synthesizing Second Strand cDNA 1 Thaw all nonenzymatic second strand components Briefly vortex and spin in a micro centrifuge before placing the tubes on ice Note It is important that all reagents be lt 16 C when the DNA polymerase I is added Add the following components in order to the 45 ul nonradioactive first strand synthesis reaction on ice 20 ul of 10x second strand buffer 6 ul of second strand dNTP mixture 114 ul of sterile dH O DEPC treated water is not required 2 ul of a 2P dNTP 800 Ci mmol Add the following enzymes to the second strand synthesis reaction 2 ul of RNase H 1 5 U ul 11 ul of DNA polymerase I 9 0 U ul Gently vortex the contents of the tube spin the reaction in a microcentrifuge and incubate for 2 5 hours in a 16 C water bath Check the water bath occasionally to ensure that the temperature does
54. e two hybrid system by commercial entities will require a license from The Regents of the University California For license information please contact University of California San Diego Technology Transfer Office Mailcode 0910 9500 Gilman Drive La Jolla California 92093 0910 Telephone 619 534 5815 Facsimile 619 534 7345 4 Cytotrap XR Library Construction Kit INTRODUCTION The CytoTrap XR library construction kit provides a novel method for detecting protein protein interactions in vivo The CytoTrap two hybrid system is based upon generating fusion proteins whose interaction in the yeast cytoplasm activates the Ras signaling pathway inducing cell growth These properties of the CytoTrap system enable researchers to study protein interactions that cannot be assayed by using conventional two hybrid or interaction trap systems These include proteins that are transcriptional activators or repressors proteins that require post translational modification in the cytoplasm and proteins that are toxic to yeast in conventional two hybrid systems The CytoTrap system uses the yeast S cerevisiae temperature sensitive mutant strain cdc25H see Host Strains and Genotypes which contains a point mutation at amino acid aa residue 1328 of the CDC25 gene CDC25 is the yeast homologue of the human Sos hSos gene encoding a guanyl nucleotide exchange factor that binds and activates Ras beginning the Ras signal transduction path
55. ed in Table III Expression of the pMyr fusion protein is induced by the presence of galactose and is repressed by the presence of glucose in the growth medium TABLE III Expected Results for Interaction of the Control Plasmids Control plasmids SD UL 25 C SD UL 37 C Sos fusion Myr fusion Glucose Galactose Glucose Galactose Mara Mare f Col mas f de d l MAFB tamne l MAFB SB PMYR TARGET VECTOR CONSTRUCTION Background The CytoTrap system is particularly useful for the identification of novel target proteins from a cDNA library that interact with a bait protein and for the subsequent determination of protein domains or amino acids critical for the interaction Specific mutations insertions or deletions that affect the encoded amino acid can be introduced into DNA encoding the target protein and the mutant target proteins can be assayed for protein protein interaction with the bait protein Figure 6 gives an overview of the cDNA synthesis procedure Cytotrap XR Library Construction Kit Oligo dT linker primer TTTTTTTTTTTTGAGCTC 57 AAAAAAAAAAAA 3 Reverse transcriptase 5 methyl dCTP dATP dGTP dTTP Messenger RNA template 5 CH3 CHa CH3 CHa CH3 Xho First strand synthesis m 5 methyl cDNA TTTTTTTTTTTTGAGCTC 5 5 RNA AAAAAAAAAAAA a RNase H DNA polymerase dNTPs Second strand synthesis 3 TTTTTTTTTTTTGAG
56. eeding see Appendix V Ethidium Bromide Plate Assay Quantitation of DNA Best results are usually obtained by ligating 60 ng of cDNA 0 1 ug of vector Place the remaining cDNA at 20 C for short term storage only The cDNA is most stable after ligation into the vector and may be damaged during long term storage Cytotrap XR Library Construction Kit 31 Ligating cDNA into the pMyr XR Vector 1 Set up a control ligation to ligate the test insert into the pMyr XR vector as follows 0 3 ul of the pMyr XR vector 0 1 pg ul 1 0 ul of XR LacZ test insert 10 ng ul 0 5 ul of 10x ligase buffer 0 5 ul of 10 mM rATP pH 7 5 2 2 ul of distilled water Then add 0 5 ul of T4 DNA ligase 4 U l To prepare the sample ligation add the following components X ul of resuspended cDNA Use 2 1 molar ratio of insert to vector 60 ng 0 5 pl of 10x ligase buffer 0 5 ul of 10 mM rATP pH 7 5 1 0 ul of the pMyr XR vector 0 1 ug ul X ul of distilled water for a final volume of 4 5 ul Then add 0 5 ul of T4 DNA ligase 4 U l Flick the tube gently to mix then spin down briefly Incubate the reaction tubes overnight at 12 C 32 Cytotrap XR Library Construction Kit XL10 GOLD KAN TRANSFORMATION GUIDELINES Storage Conditions Aliquoting Cells Ultracompetent cells are sensitive to even small variations in temperature and must be stored at the bottom of a 80 C freezer Transferring tubes from one freezer to another ma
57. ein Isolation 140 mM NaCl 2 7 mM KCl 10 mM Na HPO4 1 8 mM KH PO4 1 Triton X 100 containing freshly added protease inhibitors 1 mM PMSF 10 pg ml aprotinin 1 uM pepstatin A 100 uM leupeptin 1 ug ml chymostatin 10x Alkaline Buffer per 50 ml 3 ml of 5 0 M NaOH 2 ml of 0 5 MEDTA 45 ml of deionized H O 2x LB Broth per Liter 20 g of NaCl 20 g of tryptone 10 g of yeast extract Add deionized H O to a final volume of 1 liter Adjust to pH 7 0 with 5 N NaOH Autoclave Alkaline Agarose 2x Loading Buffer 200 pl of glycerol 750 ul of water 2x LB Agarose 450 ml of 2x LB 1 35 g of SeaPrep agarose Mix on a heated stir plate using a large stir bar until the agarose is in solution Cytotrap XR Library Construction Kit 71 46 ul of saturated BPB 5 ul of 5 M NaOH To make saturated BPB add a small amount of bromophenol blue crystals to water and vortex Centrifuge the sample briefly and look for the presence of an orange pellet If a pellet is seen the solution is saturated If not add more crystals and repeat the procedure LB Agar per Liter 10 g of NaCl 10 g of tryptone 5 g of yeast extract 20 g of agar Add deionized H O to a final volume of 1 liter Adjust pH to 7 0 with 5 N NaOH Autoclave Pour into petri dishes 725 ml 100 mm plate LB Agar IPTG X gal Plates To LB chloramphenicol agar autoclaved and cooled to 55 C add X gal stock made in dimethylformamide DM
58. es at room temperature 22 25 C until colonies are visible 4 6 days Patch the transformants that grow on the SD glucose UL plates to two SD glucose CUL and two SD galactose UL plates Incubate one of each type of plates at room temperature 22 25 C and at 37 C for gt 4 days Determine the growth phenotype of the cotransformants and compare results to the expected results in Table VII 58 Cytotrap XR Library Construction Kit TABLE VII Verification of the Specificity of the Interaction between the Bait and Target Proteins SD UL 37 C after patching SD Glucose Glucose Galactose Yeast transformation L 25 C pSos MAFB pMyr MAFB pSos MAFB pMyr Lamin C pSos Bait pMyr cDNA qp putative positive a This cotransformation serves as a positive control o This cotransformation serves as a negative control a Perform this transformation for each putative positive There may be more than one The combination of growth on glucose and growth on galactose is confirmation of the putative positive Method B Yeast Mating A segregant cdc25H o strain that contains only the pMyr cDNA plasmid is generated from the putative positive clones by a curing process cdc25H strain a cells containing the pMyr cDNA plasmid are then mated with cdc25H strain a cells transformed with the pSos bait plasmid or transformed with irrelevant baits The diploids are then
59. ffer is added before the correct temperature is reached the agarose may not solidify Load the sample in an equal volume of alkaline agarose 2x loading buffer Run the gel with 1x alkaline buffer at 100 mA and monitor the system for heat If the apparatus becomes warmer than 37 C the amperage should be reduced The migration of the BPB in alkaline agarose is similar to the migration in regular agarose and should be run to at least one half or three quarters distance of the gel Note The alkali condition causes the blue dye to fade 66 Cytotrap XR Library Construction Kit See Preparation of Media and Reagents Cytotrap XR Library Construction Kit 67 APPENDIX V ETHIDIUM BROMIDE PLATE ASSAY QUANTITATION OF DNA An accurate quantitation of DNA can be obtained by UV visualization of samples spotted on EtBr agarose plates DNA samples of known concentration are prepared for use as comparative standards in this assay Preparation of Ethidium Bromide Plates Note Prepare the EtBr plates under a fume hood Prepare 100 ml of a 0 896 w v agarose and Tris acetate media Cool the molten agarose to 50 C and then add 10 ul of EtBr stock solution 10 mg ml The EtBr stock solution is prepared in dH O and is stored in the dark at 4 C Swirl to mix the EtBr stock solution and pour the solution into 100 mm petri dishes using 10 ml plate Allow the plates to harden and incubate the plates at 37 C to dry if necessary T
60. here should be no gap between the pipet and the syringe when joined by the connecting tube Note The inside diameter of the plastic tubing 1 8 inch i d snugly connects most disposable 1 ml pipets and the ends of all B D 10 cc syringes with the Luer Lok tips Rapidly and forcefully push the plunger into the syringe to thrust the cotton plug down into the tip of the pipet Note It may take several attempts to drive the cotton all the way down into the tip of the pipet However pushing the cotton plug as far down into the pipet tip as possible is Cytotrap XR Library Construction Kit 29 important in order to achieve optimal separation of the cDNA fractions f Remove the plunger from the syringe Because the syringe functions as a buffer reservoir for the drip column leave the syringe firmly attached to the pipet throughout the remainder of the size fractionation procedure 3 Locate a support for the assembled drip column Butterfly clamps or a three fingered clamp on a ring stand can be used e Syringe 10 ml SpernNwbhUAN OO lt Connecting tube 8 mm We 3 lin 1 10ml TD 20 lt 4 ml graduation Pipet 1 ml Qe iw S G G Cotton plug 26 Cytotrap XR Library Construction Kit FIGURE 7 Assembly of the drip columns Cytotrap XR Library Construction Kit 27 Loading the Drip
61. hese plates may be stored in the dark at 4 C for up to 1 month Preparation of Standards Using a DNA sample of known concentration make seven serial dilutions in 100 mM EDTA to cover the range from 200 to 10 ng ul These standards may be stored at 20 C for 3 months Plate Assay for Determination of DNA Concentration Using a marker label the petri dish to indicate where the sample and the standards 200 150 100 75 50 25 and 10 ng ul will be spotted Thaw the standards and carefully spot 0 5 ul of each standard onto the surface of a prepared EtBr plate Be careful not to dig into the surface of the plate Let capillary action pull the small volume from the pipet tip to the plate surface and do not allow a bubble to form Change pipet tips between each standard After spotting all of the standards immediately spot 0 5 ul of the cDNA sample onto the plate adjacent to the line of standards Allow all spots to absorb into the plate for 10 15 minutes at room temperature Remove the lid and photograph the plate using a UV lightbox Compare the spotted sample of unknown concentration with the standards Do not reuse the plates Standards and unknowns must be spotted within 10 minutes of each other 68 Cytotrap XR Library Construction Kit TROUBLESHOOTING cDNA Synthesis Observation Poor first strand synthesis Poor second strand synthesis Suggestion Always mix and spin the enzymes in a microcentrifuge imme
62. hod by which the transcription and processing of mRNA can be examined and interpreted The cDNA Synthesis Kit uses a hybrid oligo dT linker primer that contains an Xho I restriction site First strand synthesis is primed with the linker primer and is reverse transcribed using AccuScript reverse transcriptase and 5 methyl dCTP AccuScript reverse transcriptase AccuScript RT is a novel Moloney murine leukemia virus reverse transcriptase MMLV RT derivative combined with a proofreading 3 5 exonuclease AccuScript reverse transcriptase delivers the highest reverse transcription accuracy while promoting full length cDNA synthesis AccuScript reverse transcriptase delivers greater than three fold higher accuracy compared to leading reverse transcriptases representing a significant advancement in cDNA synthesis accuracy These advantages make AccuScript RT the enzyme of choice for applications involving the preparation of accurate full length cDNA transcripts including first strand cDNA synthesis and library construction The use of 5 methyl dCTP during first strand synthesis hemimethylates the cDNA which protects the cDNA from digestion with certain restriction endonucleases such as Xho I Therefore on Xho I digestion of the cDNA only the unmethylated site within the linker primer is cleaved Hemimethylated DNA introduced into an McrA McrB strain would be subject to digestion by the mcrA and mcrB restriction systems Therefore it
63. in either the first or second strand reactions when the newly polymerized strand snaps back on itself and forms an antiparallel double helix Denaturing gels such as alkaline agarose gels can reveal this secondary structure and can demonstrate the size range of the first and second strand cDNA Note The test cDNA sample will run as a tight band at 1 8 kb and will show distinctly different intensity between the first and second strands This is due to the relative ratio of a P to the amount of NTP in the first or second strand reaction Normally the second strand will be only 1 10 to 1 20 the intensity of the first strand band Alkaline agarose gels differ from conventional gels in the following ways 1 The absence of any buffering capacity in the buffer reduces the speed at which the sample can be run 2 The thickness of the typical undried agarose gel causes the radioactive emissions to be scattered to a degree which makes a clear autoradiograph difficult to interpret The following alternative methods help avoid these complications The Slide Technique The easiest and least expensive method is to use a 5 x 7 5 cm glass slide position a minigel comb over it with high tension clips and add 10 ml of molten alkaline agarose near the upper center of the slide The surface tension of the solution will prevent overflow and produce a small thin gel which can be exposed without further drying Do not allow the teeth of the co
64. ined as the point where the pipet and the syringe are joined Notes If air bubbles form as the resin packs use a Pasteur pipet as described in step 1b to remove the blockage Failure to remove bubbles can impede the flow of the column and result in a loss of the cDNA If the preparation of Sepharose CL 2B gel filtration medium settles and becomes too viscous to transfer from the stock tube to the column add a small volume 1 5 ml of 1x STE buffer to resuspend the resin 28 Cytotrap XR Library Construction Kit 2 Wash the drip column by filling the buffer reservoir i e the syringe with a minimum of 10 ml of 1x STE buffer As the column washes the buffer should flow through the drip column at a steady rate however it may take at least 2 hours to complete the entire wash step After washing do not allow the drip column to dry out because the resin could be damaged and cause sample loss If this occurs pour another column Note If a free flow of buffer is not observed then bubbles or pockets of air have become trapped in the drip column In this case the column must be repacked If cDNA is loaded onto a column on which a free flow of buffer is not observed the sample could become irretrievably lost 3 When 50 ul of the STE buffer remains above the surface of the resin immediately load the cDNA sample using a pipettor Gently release the sample onto the surface of the column bed but avoid disturbing the resin as
65. is necessary to initially transform an McrA McrB strain e g the XL10 Gold Kan strain supplied with the CytoTrap system when using the cDNA Synthesis Kit After passing the library through XL10 Gold Kan cells the DNA is no longer hemimethylated and can be grown on McrA McrBP strains e g XL1 Blue strain Cytotrap XR Library Construction Kit CDNA Synthesis The yield length and accuracy of cDNA transcripts is enhanced with the use of AccuScript RT an engineered version of the Moloney murine leukemia virus reverse transcriptase combined with a proofreading 3 5 exonuclease First strand cDNA synthesis begins when AccuScript RT in the presence of nucleotides and buffer finds a template and a primer The template is mRNA and the primer is a 50 base oligonucleotide with the following sequence 5 GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3 GAGA Sequence XhoI Poly dT This oligonucleotide was designed with a GAGA sequence to protect the Xho I restriction enzyme recognition site and an 18 base poly dT sequence The restriction site allows the finished cDNA to be inserted into the pMyr XR vector in a sense orientation EcoR I Xho I with respect to the Por The poly dT region binds to the 3 poly A region of the mRNA template and AccuScript RT begins to synthesize the first strand cDNA The nucleotide mixture for the first strand contains normal dATP dGTP and dTTP plus the analog 5 methyl dCTP The complete fir
66. it protein see Yeast Transformation and Assay for Growth Phenotype Verify that correct control plasmid pairs are used Verify the phenotype of a yeast colony as described in Preparation of Yeast Host Strain and prepare new yeast competent cells using the same yeast colony Use sterile technique when preparing and transforming the yeast competent cells to avoid contamination of the culture with different yeast strain s or with E coli Verify that media was made correctly to select for both control plasmids Verify that the correct control plasmid pair is used Verify that the correct control plasmid pair is used Verity the nucleotide sequence of the Sos and insert DNA to ensure the bait protein is expressed It is possible that the target proteins exist at a low frequency in the library prepare and screen additional cotransformants screen a different library It is possible that the target proteins do not exist in the library Screen a library in which expression of the bait protein is known Verify the pH of the SD agar plates using a pH indicator strip Vary the fusion point of the Sos and the bait protein to avoid problems caused by steric inhibition Verify that the competent cells containing the bait plasmid were used to transform the target plasmid s Plasmid Isolation from Yeast Observation Absence of Amp or Cam colonies when E coli is transformed with DNA isolated from yeast No discernib
67. l pp 131 132 Stockton Press New York Hanahan D Jessee J and Bloom F R 1991 Methods Enzymol 204 63 113 Ausubel F M Brent R Kingston R E Moore D D Seidman J G et al 1987 Current Protocols in Molecular Biology John Wiley amp Sons New York Callahan M Jerpseth B Mullinax R L and Greener A 1995 Strategies 8 2 45 46 Germino F J and Moskowitz N K 1999 Methods Enzymol 303 422 50 Phizicky E M and Fields S 1995 Microbiol Rev 59 1 94 123 Krug M S and Berger S L 1987 Methods Enzymol 152 316 25 SUPPLEMENTAL REFERENCES 0200 OY Or A DO Tes NNNP RP RP RP RP RP RP RP Re NPSoWAN DUB WNP SO Allen J B et al 1995 Trends Biochem Sci 20 511 516 Aronheim A et al 1994 Cell 78 949 961 Aronheim A et al 1997 Mol Cell Biol 17 3094 3102 Cohen S et al 1981 Nature London 294 182 184 Colicelli J et al 1989 Proc Natl Acad Sci USA 86 3599 3603 Chien C T et al 1991 Proc Natl Acad Sci USA 88 9578 9582 Estojak J et al 1995 Mol Cell Biol 15 5820 5829 Fields S and Song O K 1989 Nature London 340 245 246 Fields S and Sterngianz R 1994 Trends Genetics 10 286 292 Gimble F S and Sauer R T 1989 J Mol Biol 206 29 39 Kataoka K et al 1994 Mol Cell Biol 14 7581 7591 Leuther K K and Johnston S 1992 Science 256 1333 1335 McNabb D S et al 1995 Genes De
68. late on a rotating platform shaker and incubate at room temperature 22 25 C for 24 hours at 220 250 rpm 3 Spot 20 ul of each mating culture on two SD glucose UL and two SD galactose CUL agar plates Transfer one plate of each type to 37 C Keep the second plate of each type at room temperature 22 25 C Score the growth at 37 C after at least 5 days incubation time The SD galactose UL agar plates that are incubated at 37 C may require up to 7 10 days incubation time for yeast colonies to appear The expected results are shown in Table VIII Cytotrap XR Library Construction Kit TABLE VII Verification of the Specificity of the Interaction between the Bait and Target Proteins SD UL 25 C SD UL 37 C after patching Yeast transformation Glucose Galactose Glucose Galactose pMyr cDNA putative positive pSos Col I pMyr cDNA putative positive pSos MAFB pMyr cDNA putative t t positive pSos Bait These matings serve as negative controls Perform both of them for each putative positive tested The combination of growth on glucose and growth on galactose is confirmation of the putative positive If transformants do not give the expected results see Troubleshooting To identify the protein encoded by the target DNA the nucleotide sequence of the target DNA can be determined and compared to protein and nuc
69. le bands following restriction analysis of the recovered plasmid DNA Suggestion Transform E coli with a greater volume of isolated DNA or reisolate plasmid DNA to insure sufficient yield of plasmid DNA from yeast plasmid isolation Continue incubation of the transformants to check for slow growth rate of the Cam transformants Transform E coli with plasmid DNA isolated from yeast before restriction analysis to ensure that the plasmid DNA is not contaminated with yeast chromosomal DNA 70 Cytotrap XR Library Construction Kit PREPARATION OF MEDIA AND REAGENTS Synthetic Glucose Minimal Medium SD Glucose UL per Liter 1 7 g of yeast nitrogen base without amino acids 5 g of ammonium sulfate 20 g of dextrose add 17 g of Bacto agar for SD dropout agar plates Adjust the total volume to 900 ml with dH O Autoclave for 15 minutes at 121 C cool to 55 C Add 100 ml of the appropriate filter sterilized 10x dropout solution see 10x Dropout Solution Synthetic Galactose Minimal Medium SD Galactose UL per Liter 1 7 g of yeast nitrogen base without amino acids 5 g of ammonium sulfate 20 g of galactose 10 g of raffinose add 17 g of Bacto agar for SD dropout agar plates Adjust the total volume to 900 ml with dH O Autoclave for 15 minutes at 121 C cool to 55 C Add 100 ml of the appropriate filter sterilized 10x dropout solution see 10x Dropout Solution Cell Lysis Buffer for Prot
70. leotide sequence databases to identify related or homologous proteins Oligonucleotide primers can be used to determine the nucleotide sequence of the target DNA In addition the target DNA can be used as a hybridization probe to screen the plasmid library for full length target DNA clones and for clones with high homology to the target DNA Discussion regarding further verification of protein protein interactions can be found in numerous publications Cytotrap XR Library Construction Kit 61 APPENDIX I GENERAL COMPARISON OF Escherichia coli VERSUS YEAST HOST STRAINS Host strain Quality feature Escherichia coli Yeast Doubling time 20 minutes gt 1 hour Complex media nonselective LB and NZY YPAD Chemically defined media selective M9 SD pH 7 neutral 5 8 acidic Growth temperature 37 C 25 C Antibiotic sensitivity Sensitive to most antibiotics Resistant to most antibiotics including ampicillin Selection method for presence of plasmid Add antibiotic to media Remove amino acid from media Colonial morphology Small flat colonies Large rounded colonies Cell diameter Odor 1 um Musty pungent 3 5 um Bread dough 62 Cytotrap XR Library Construction Kit APPENDIX II RNA PURIFICATION AND QUANTIFICATION RNA Purification The Stratagene RNA Isolation Kit using the guanidinium thiocyanate phenol chloroform extraction method is strongly
71. let in 9 ul of EcoR I adapters and incubate at 4 C for at least 30 minutes to allow the cDNA to resuspend To ensure that the CDNA is completely in solution transfer the cDNA to a fresh microcentrifuge tube Monitor the now empty tube with a handheld Geiger counter If the cDNA is in solution few counts should remain in the empty tube Transfer 1 ul of this second strand synthesis reaction to a separate tube This radioactive sample is the second strand synthesis control reaction Analyze the samples of the first and second strand synthesis reactions on an alkaline agarose gel at this point It is important to determine the size range of the cDNA and the presence of any secondary structure see Appendix IV Alkaline Agarose Gels Note The second strand synthesis reaction can be stored overnight at 20 C Ligating the EcoR Adapters 1 2 Add the following components to the tube containing the blunted cDNA and the EcoR I adapters 1 ul of 10x ligase buffer 1 ul of 10 mM rATP 1 ul of T4 DNA ligase 4 U ul Spin down the volume in a microcentrifuge and incubate overnight at 8 C Alternatively the ligations can be incubated at 4 C for 2 days 22 Cytotrap XR Library Construction Kit 3 In the morning heat inactivate the ligase by placing the tubes in a 70 C water bath for 30 minutes Cytotrap XR Library Construction Kit 23 Phosphorylating the FcoR Ends 1 After the ligase is heat inactivated spin the re
72. lishing an Agar Plate Yeast Streak eese 10 Preparation of a 80 C Yeast Glycerol Stock eese 10 Host Strains and Gemotypes cccccssscssscsescssscssccensesnscsnsscnscesecessssscescesscesesesenesensesnaesenes 11 Verification of Yeast Host Strain Marker Phenotype sese 11 Control Plasmids t cp 12 DOS CHIP tO T 12 AppIEatiODs e ne ret ae eh tee Ete ee e DA DE t tee De EUN 14 Expected Results Rr Ree ee entis de Per ee hereto tle Fee igit 14 pMyr Target Vector Construction sessssessesossssessesosssossosseseesosossesoesossssesossossesessossssesoesossssssossoseso 14 Background etn er REPRE De ER RR n t ER Eee 14 cDNA Insert Preparation and Ligation eese eene entrent nnne 16 XL10 Gold Kan Transformation Guidelines eee eee ee ee esses eese en ene tn sten sns tn atta tnnsens 33 Storage Conditions nte tae ti t re n ee e REN REA E Eee E opbavedens 33 Aliq oting Cells 3 2 e rre Re ER ERR RE ENTRE a EFE HE n P t EE ees 33 Use of 14 ml BD Falcon polypropylene tubes eeeeseeeeeeeereeeenen rennes 33 Use of D Mercaptoethanol esses ennt ennt nennen nennen enne tenn trennen 33 Length of the Heat Pulse eee tpe tete P tI e ERE PR ERE Pee er ee ERE bee 33 Preparing the Agar Plates for Color Screening seen 33 Transforming XL
73. ly for selection of yeast transformants based on nutritional requirements The pSos vector contains the ampicillin resistance gene and the pMyr vector contains the chloramphenicol resistance gene to rapidly distinguish between the two vectors when recovering plasmids from E coli Table I contains a list of unique restriction sites for pSos and pMyr TABLE Unique Restriction Sites in the MCS pSos pMyr Bam HI EcoR Nco Sif Sma Sif Xho Aat II Sal Sal BssH Il Mlu Sac Not To ensure complete digestion with Not use 10U enzyme per ug DNA and incubate the digestion reaction mixture overnight at 37 C Cytotrap XR Library Construction Kit pSos Vector P ADHI 2 micron ori 11 3 kb NL A y LEU2 ML p p lpUC an d ampicillin pSos Multiple Cloning Site Region sequence shown 3201 299 end of hSos Fame lins pn nd ll p pen ll CCA AGG AAA ATT AGT TAT AGT AGG ATC CCC ATG GCC CGG GCG ACG TCG ACG nn i Mer ia ll pag l rag I CGC GCA CGC GTG AGC TCG CGG CCG CCG CGG TIA AIT BAT si TUA AUG STOP STOP STOP STOP Notes The Sac II and Pac I sites in the pSos MCS shown in bold are not unique A stop codon is present in all three reading frames Feature Nucleotide Position hSos ORF 24 3209 multiple cloning site 3223 3276 yeast ADHI terminator 3413 3741 pUC origin of replication 4064 4731 ampicillin
74. m more than one round of amplification as slower growing clones may be significantly underrepresented We recommend amplifying plasmid libraries in 500 ml bottles of 2x LB agarose see Preparation of Media and Reagents using the semi solid amplification method The libraries are amplified in suspension which allows for three dimensional uniform colony growth This reduces the potential for under representation of particular clones due to the overgrowth of some colonies during the expansion process that accompanies direct plating methods Notes Each 500 ml bottle of 2x LB agarose can accommodate 5 x 10 primary cfu To amplify a library of 1 x 106 primary cfu two bottles are necessary Cytotrap XR Library Construction Kit 37 10 We have observed that the use of SeaPrep agarose is critical to ensure optimal amplification On a heated stir plate using a large stirbar combine 1 35g of SeaPrep agarose with 450 ml of 2x LB broth see Preparation of Media and Reagents in each 500 ml autoclavable bottle Heat and stir until the agarose is in solution Autoclave the bottles and stir bars for 30 minutes Allow the bottles to cool to 37 C in a water bath 1 hour Transfer the bottles to a stir plate and add 50 ug ml of chloramphenicol Add up to 5 x 10 cfu bottle of primary library and stir for several minutes Note The bottles must be handled very carefully at this stage Avoid swirling or bumping the bottles as this
75. mb to overlap the edge of the plate or the surface tension may be broken To improve the resolution pat the gel dry with several changes of Whatman 3MM paper after electrophoresis is complete To prevent radioactive contamination of film cassettes seal the wet gels in airtight hybridization bags Be careful not to trap any air in the hybridization bag which could lift the film away from the gel and cause blurring The Vertical Alkaline Agarose Technique Vertical alkaline agarose gels can be produced using a vertical gel apparatus with 1 5 mm spacers Since the alkaline agarose gels do not have sufficient friction to remain bound to ordinary glass a frosted glass plate or gel bond must be used with the vertical apparatus The combs normally used for acrylamide can be used with this apparatus if the outside teeth are wrapped Cytotrap XR Library Construction Kit 65 in tape to prevent the comb from sinking more than 1 2 cm into the agarose The 55 C agarose will solidify almost immediately on contact with the cold glass plates so it is essential to load the mold rapidly with a 60 ml syringe The comb should already be in the mold and if it is necessary to reposition the comb do it immediately after the gel is poured In order to reduce the possibility of destroying the wells when pulling out the comb place the solidified gel in a 20 C freezer for 5 minutes immediately prior to removing the comb When pulling out the comb it is essenti
76. merge the microcentrifuge tubes in a 0 196 v v DEPC treated water solution Leave the beaker of submerged tubes in a fume hood overnight and then dispose of the DEPC treated water Autoclave the microcentrifuge tubes for at least 30 minutes Even though the tubes may still have a sweet DEPC odor the DEPC is completely inactivated by this procedure Place the tubes in a drying oven overnight Equipment which cannot be treated by DEPC can be rinsed in a freshly mixed 396 v v hydrogen peroxide solution followed by a methanol rinse Remember once the RNA is converted to first strand cDNA RNases are no longer a concern Caution should still be exercised in maintaining a sterile DNase free environment RNA Quantification RNA can be quantified by measuring the optical density of a dilute RNA solution The conversion factor for RNA at the wavelength of 260 nm is 40 ug ml OD unit as shown in the example below Two microliters of an unquantified poly A sample is added to 498 ml of water OD 9 0 1 Cytotrap XR Library Construction Kit 63 0 1 OD unit x dilution factor x 40 ug ml 1000 ug ml or 1 pug ul If a sample has significant rRNA contamination the actual amount of mRNA available for cDNA conversion will be overestimated by this procedure If the amount of mRNA is below 1 5 pg synthesis reaction the RT may synthesize unclonable hairpin structures If the amount of mRNA is above 7 ug the percentage of cDNAs which are f
77. n 200 ul of Cell Lysis Buffer for Protein Isolation see Preparation of Media and Reagents containing freshly added protease inhibitors 1 mM PMSF 10 ug ml aprotinin 1 uM pepstatin A 100 uM leupeptin 1 ug ml chymostatin 2 Vortex the cells for 5 minutes at 4 C with an equal volume of acid washed glass beads 0 5 mm in diameter Monitor cell lysis by phase contrast microscopy until gt 70 of the yeast cells appear transparent i e ruptured and void of cellular contents Cytotrap XR Library Construction Kit 5 3 Collect the lysate by centrifugation at 12 000 x g for 5 minutes at 4 C 4 Transfer the supernatants to fresh 1 5 ml screw cap tubes and place on ice 5 Add 100 ul of Cell Lysis Buffer for Protein Isolation to the pellet glass beads and vortex vigorously for 5 minutes at 4 C 6 Collect the lysate by centrifugation at 12 000 x g for 5 minutes at 4 C 7 Combine each supernatant with the corresponding first supernatant Protocol B 1 Resuspend the yeast cell pellet with 1 ml of cold dH O 2 Add 150 pl of freshly made NaOH B ME buffer to the cell suspension 3 Vortex the cells for 30 seconds and incubate on ice for 15 minutes 4 Vortex again then add 150 ul of 55 TCA in water Vortex and place the cells on ice for 10 minutes 5 Collect the protein extracts by centrifugation at 12 000xg for 10 minutes at 4 C Remove the supernatant and centrifuge again to remove any residual supernatant 6 Resuspend the
78. n Kit MATERIALS PROVIDED Materials provided Quantity Vectors pSos vector supercoiled 20 ug 1 pg pl in TE buffer pMyr XR vector digested with EcoR I Xho and treated with 5 ug 0 1 ug ul in TE buffer calf intestinal alkaline phosphatase CIAP pMyr vector supercoiled 20 ug 1 pg pl in TE buffer Test insert XR LacZ test insert 600 bp digested with Xho and EcoR I 30 ng 10 ng pl in TE buffer Control plasmids pSos MAFB control plasmid positive control 20 ug 1 pg pl in TE buffer pMyr MAFB control plasmid positive control 20 ug 1 ug ul in TE buffer pSos Col control plasmid negative control 20 ug 1 pg pl in TE buffer pMyr Lamin C control plasmid negative control 20 ug 1 ug ul in TE buffer pMyr SB positive control 20 ug 1 ug ul in TE buffer Host strains cdc25H host strains a and a 0 5 ml each XL10 Gold Kan ultracompetent cells 10 x 100 ul pUC18 DNA control plasmid 0 1 ng pl in TE buffer 10 ul XL10 Gold B Mercaptoethanol mix B ME 50 ul cDNA synthesis kit 1 kit On arrival store the pMyr XR vector at 20 C After thawing aliquot and store at 20 C Do not pass through more than two freeze thaw cycles For short term storage store at 4 C for 1 month Store the pMyr and pSos vectors at 20 C Store at 20 C 4 Store at 80 C e On arrival store the competent cells immediately at 80 C Do not place the cells in liquid ni
79. oclaved glycerol 25 v v SU Buffer 5 w v SDS 8 M Urea 125 mM Tris HCl pH 6 8 0 1 mM EDTA 0 00596 w v bromophenol blue Store at 20 C Add 15 mg of DTT ml of SU buffer prior to use YPAD Broth 1 yeast extract 2 Bacto peptone 2 dextrose 40 mg adenine sulfate Add deionized H O to a final volume of 1 liter Autoclave at 121 C for 20 minutes Yeast Lysis Solution for DNA Isolation 2 5 M LiCl 50 mM Tris HCl pH 8 0 4 Triton X 100 62 5 mM EDTA YPAD Agar 30 40 Plates Liter 1 yeast extract 2 Bacto peptone 2 dextrose 2 Bacto agar 40 mg adenine sulfate Autoclave at 121 C for 20 minutes Dry the plates at room temperature for 2 3 days Store the plates in a sealed bag 74 Cytotrap XR Library Construction Kit 10x Dropout Solution To prepare the appropriate 10x dropout solution for the desired synthetic selection medium simply omit the appropriate component as indicated in the footnote to Table IX that follows All amino acids and nutrients can be autoclaved with the exception of threonine and aspartic acid which must be filter sterilized After sterilization the 10x dropout solutions can be stored in 100 ml aliquots at 4 C for up to 1 year TABLE IX Formulation of 10x Dropout Solution Components Weight mg liter Sigma Catalog L lsoleucine 300 12752 Valine V 0500 L Adenine hemisulfate salt A 9126 L Arginine HCI 500 A 5131 L Histidine HCl monohydrate 200 H 812
80. ome familiar with the procedures Review of the Troubleshooting section may also prove helpful The drip columns should be prepared and the cDNA should be eluted in 1 day Because a full day is required to complete these procedures gathering all necessary materials in advance is recommended see the Equipment section in Additional Materials Required 1 Perform the following preparatory steps while assembling the drip columns Remove the Sepharose CL 2B gel filtration medium and the 10x STE buffer from refrigeration and equilibrate the two components to room temperature Prepare 50 ml of 1x STE buffer by diluting 10x STE buffer 1 10 in sterile water 2 Assemble the drip columns as outlined in the following steps see Figure 7 for a diagram of the final setup Note Wear gloves while assembling the drip columns Remove the plastic wrapper from the top of a sterile 1 ml pipet Using a sterile needle or a pair of fine tipped forceps carefully tease the cotton plug out of each pipet leaving a piece of the cotton plug measuring 3 4 mm inside Cut off the external portion of the cotton plug Push the remaining 3 to 4 mm piece of the cotton plug into the top of each pipet with the tip of the needle or forceps Cut a small piece of plastic tubing measuring 8 mm Use this small tube to connect the 1 ml pipet to the 10 ml syringe First attach one end of the connecting tube to the pipet and then connect the other end to the syringe T
81. on Kit because this phenol is too acidic and will denature the DNA Ethanol EtOH 70 and 100 v v Sterile distilled water dH O o 2P Deoxynucleoside triphosphate a P dNTP 800 Ci mmol a P dATP a 32P dGTP or o P dTTP may be used do not use a 7P dCTP Acid washed glass beads 425 600 um VWRbrand 3 mm glass beads VWR Scientific Westchester Pennsylvania Catalog 26396 630 p mercaptoethanol for preparation of yeast competent cells dilute B ME stock 1 10 from 14 2 M to 1 4 M with dH O just prior to use Yeast extract Bacto peptone Bacto agar Yeast nitrogen base Ammonium sulfate SeaPrep ultralow gelling temperature agarose FMC Rockland Maine Catalog 50302 IPTG X gal Sos1 antibody BD Biosciences Catalog 610095 or 610096 XL 1 Blue electroporation competent cells pMyr specific primers Cell lysis buffer Dextrose Galactose Raffinose LiSORB NZY broth PEG Lithium acetate solution SU buffer Salmon sperm DNA YPAD broth Yeast lysis solution 10x Dropout solution 8 See Preparation of Media and Reagents Cytotrap XR Library Construction Kit 3 Sequencing Primers and Sequences Sequencing primers Sequence Sos 5 primer 5 CCAAGACCAGGTACCATG 3 Sos 3 primer 5 GCCAGGGTTTTCCCAGT 3 Myr 5 primer 5 ACTACTAGCAGCTGTAATAC 3 Myr 3 primer 5 CGTGAATGTAAGCGTGACAT 3 5 primer is at the
82. or a see Note below from the glycerol stock by scraping off splinters of solid ice with a sterile wire loop Streak the splinters onto a YPAD agar plate Incubate the plate at room temperature 22 25 C until colonies appear 4 days Alternatively use a previously prepared plate less than one week old Note Prepare competent cells from both mating types a and a if performing single plasmid transformations that will be mated 2 Pick 4 5 cdc25H yeast colonies from a plate that is less than one week old into separate 1 5 ml microcentrifuge tubes containing 1 ml YPAD Vortex vigorously until cell clumps are completely dispersed Note We recommend generating 4 5 independent preparations of yeast competent cells derived from independent colonies due to the ability of the cdc25H strain to produce revertants of the temperature sensitive phenotype during growth 3 Transfer the yeast cell suspensions into 250 ml flasks each containing 50 ml YPAD Incubate at room temperature 22 25 C with shaking at 220 250 rpm for 14 16 hours 4 Measure the ODgo9 of the cultures It must be gt 1 If the ODeoo is lt 1 continue incubating the culture and monitoring the ODgoo If after 19 hours the ODgop is not greater than 1 it is necessary to start again with step 2 above making sure that the yeast plate from which the colonies are picked is not more than one week old Cytotrap XR Library Construction Kit 43 Grow cdc25H strain
83. ose UL p5os MAFB 6s pMyr Lamin C 300 ng each 100 ul SD glucose UL pSos Col 7 pMyr MAFB 300 ng each 100 ul SD glucose UL pSos MAFB 8 pMyr SB 300 ng each 100 ul SD glucose UL 9 pSos Bait 100 ng 100 ul SD glucose L pSos Bait 10 pMyr Lamin C 300 ng each 100 ul SD glucose UL pSos Bait 11 pMyr SB 300 ng each 100 ul SD glucose UL a This cotransformation is used to determine the number of yeast revertants and the transformation efficiency These cotransformations serve as positive controls These cotransformations serve as negative controls 4 This cotransformation is a control that confirms the integrity of the pSos vector For complete plating instructions see step 10 2 the SB protein expressed from pMyr SB interacts with the Sos protein expressed from pSos Bait to rescue the growth at 37 C when plated on SD galactose UL Add 2 ul of 1 4 M B mercaptoethanol to each tube Mix the contents of each tube thoroughly but gently by inversion or tapping Incubate the transformation suspensions at room temperature for 30 minutes with occasional tapping Heat shock the transformation suspensions at 42 C for 20 minutes 46 Cytotrap XR Library Construction Kit 5 Place the transformation suspensions on ice for 3 minutes 6 Collect the cells by centrifugation for 30 seconds at 14 000 rpm at room temperature Remove and discard the
84. ough this material elutes from the column in parallel with the dye unincorporated nucleotides are usually not collected because the cDNA has already eluted from the column Cytotrap XR Library Construction Kit 29 For standard cDNA size fractionation gt 400 bp collect 12 fractions using the procedure described in this section The progression of the leading edge of the dye through the column will be used as a guideline to monitor collection however the drops collected from the column should be monitored for radioactivity using a handheld Geiger counter Until the fractions have been assessed for the presence of cDNA on a 5 nondenaturing acrylamide gel see Preparation of Media and Reagents do not discard any fractions based on the quantity of radioactivity detected 1 Using a fresh microcentrifuge tube to collect each fraction begin collecting three drops per fraction when the leading edge of the dye reaches the 0 4 ml gradation on the pipet 2 Continue to collect fractions until the trailing edge of the dye reaches the 0 3 ml gradation A minimum of 12 fractions each containing 100 pl i e three drops should be collected Alternatively fractions can be collected until the radioactive unincorporated nucleotides begin to elute In either case monitor the fractions for the presence of radioactivity to determine whether the cDNA has eluted successfully If no counts are detected continue collecting the fractions until the
85. peak of unincorporated nucleotides is recovered 3 Before processing the fractions and recovering the size fractionated cDNA remove 8 ul of each collected fraction and save for later analysis These aliquots will be electrophoresed on a 5 nondenaturing acrylamide gel to assess the effectiveness of the size fractionation and to determine which fractions will be used for ligation Processing the cDNA Fractions In this section of the size fractionation procedure the fractions collected from the drip column are extracted with phenol chloroform and are precipitated with ethanol to recover the size selected cDNA The purpose of the organic extractions is to remove contaminating proteins of particular concern is kinase which can be carried over from previous steps in the synthesis Because kinase often retains activity following heat treatment it is necessary to follow the extraction procedures 1 Begin extracting the remainder of the collected fractions by adding an equal volume of phenol chloroform 1 1 v v 2 Vortex and spin in a microcentrifuge at maximum speed for 2 minutes at room temperature Transfer the upper aqueous layer to a fresh microcentrifuge tube 3 Add an equal volume of chloroform 4 Vortex and spin in a microcentrifuge at maximum speed for 2 minutes at room temperature Transfer the upper aqueous layer to a fresh microcentrifuge tube 30 Cytotrap XR Library Construction Kit 5 To each extracted sample
86. rary Construction Kit 77
87. resistance bla ORF 4882 5739 yeast LEU2 selection marker ORF 6498 7589 2u yeast origin of replication 7993 8747 yeast ADH promoter 9806 11259 Cytotrap XR Library Construction Kit 7 FIGURE 2 The pSos vector Cytotrap XR Library Construction Kit pMyr Vector myr MCS P GALI T CYCI Fl ori X NJ PUC ori pMyr 6 0 kb REN T chloramphenicol URA3 pMyr Multiple Cloning Site Region sequence shown 22 20 myristylation signal Xba EcoR 2 ATG GGG AGT AGC AAG AGC AAG CCT AAG GAC CCC AGC CAG CGC CGG TCT AGA GAA TTC START Sif om id da ie l GCC CGG GCC TCG AGG TCG ABT BAT edi ATA ATA AGC TCT AGA STOP STOP STOP Notes The Xba I sites in the pMyr MCS shown in bold are not unique A stop codon is present in all three reading frames Feature Nucleotide Position myristylation signal 22 66 multiple cloning site 73 98 yeast CYCT terminator 121 387 pUC origin of replication 568 1235 chloramphenicol resistance ORF 1378 2034 yeast URAS selection marker ORF 2482 3282 2u yeast origin of replication 3512 4983 fl origin of ss DNA replication 5183 5489 yeast GAL promoter 5527 5977 FIGURE 3 The pMyr vector Cytotrap XR Library Construction Kit 9 PREPARATION OF YEAST HOST STRAIN Note The temperature sensitive phenotype of the cdc25H host strain reverts during yeast growth and the reversion frequency is increased by growing the strain
88. ria in a single sterile flask with a cap 9 Take half of the pooled bacteria and perform an alkaline lysis CsCl gradient purification of the plasmid DNA This DNA is suitable for transformation of yeast 10 To the remainder of the pooled bacteria add 0 2 volumes of 80 glycerol and mix thoroughly by inverting the flask 11 Dispense 1 ml aliquots into sterile 1 5 ml microcentrifuge tubes and freeze at 80 C These aliquots can be used to inoculate liquid culture for preparation of additional DNA They can be also used for further amplification by plating on LB chloramphenicol plates repeat steps 4 through 8 or by semi solid agar method Verifying the Insert Percentage and Size Individual colonies can be examined to determine the percentage of vectors with inserts and the average insert size by either PCR directly from the colony with Myr specific primers or by restriction analysis of individually prepared plasmid DNA The LacZ test insert is 600 bp in length Suggested Sequencing Primers Sequencing primers Sequence Sos 5 primer 5 CCAAGACCAGGTACCATO 3 Sos 3 primer 5 GCCAGGGTTTTCCCACGT 3 Myr 5 primer 5 ACTACTAGCAGCTGTAATAC 3 Myr 3 primer 5 CGTGAATGTAAGCGTGACAT 3 5 primer is at the 5 end of the MCS and 3 primer is at the 3 end of the MCS Amplifying the pMyr cDNA Library Amplification of the library is desirable to produce a large and stable quantity of the library Do not perfor
89. rt Cloning and Expression Select isolated colonies for miniprep analysis to identify transformed colonies containing the pSos vector with the DNA insert The nucleotide sequence of the cloning junctions and DNA insert should be determined to verify that the bait protein will be expressed in frame with the Sos domain and that the DNA insert does not contain mutations Expression of the bait protein may be verified by Western blot analysis using an antibody that immunoreacts either with the protein expressed from the DNA insert or with the hSos protein see Verifying Bait Protein Expression However if the antibody used fails to detect expression of the bait protein the bait protein may still be useful for detecting two hybrid interactions The ability of the antibody to detect the bait protein is dependent on several factors including the affinity of the antibody for the bait protein and the expression level of the bait protein After analyzing expression of the bait protein by western blot analysis the cytoplasmic localization of the bait protein can be verified by cotransformation of pMyr SB and the pSos bait plasmid followed by patching on galactose containing medium and assaying for growth at 37 C Verification of Bait Plasmid Suitability for CytoTrap Interaction Assays Prior to initiating a CytoTrap two hybrid assay or screen using a particular bait verify that the pSos bait fusion does not interact with the myristylation signal in the
90. st strand will have a methyl group on each cytosine base which will protect the cDNA from restriction enzymes used in subsequent cloning steps During second strand synthesis RNase H nicks the RNA bound to the first strand cDNA to produce a multitude of fragments which serve as primers for DNA polymerase I DNA polymerase I nick translates these RNA fragments into second strand cDNA The second strand nucleotide mixture has been supplemented with dCTP to reduce the probability of 5 methyl dCTP becoming incorporated in the second strand This ensures that the restriction sites in the linker primer will be susceptible to restriction enzyme digestion The uneven termini of the double stranded cDNA are nibbled back or filled in with cloned Pfu DNA polymerase and EcoR I adapters are ligated to the blunt ends The adapters have the sequence shown below 5 OH AATTCGGCACGAGG 3 3 GCCGTGCTCCp 5 These adapters are composed of 10 and 14 mer oligonucleotides which are complementary to each other with an EcoR I cohesive end The 10 mer oligonucleotide is phosphorylated which allows it to ligate to other blunt termini available in the form of cDNA and other adapters The 14 mer oligonucleotide is kept dephosphorylated to prevent it from ligating to other cohesive ends After adapter ligation is complete and the ligase has been heat inactivated the 14 mer oligonucleotide is phosphorylated to enable its ligation into the dephosphorylated vector arms
91. tep 10 of Transforming Yeast and Detecting Protein Protein Interactions contain only single plasmids and the colonies from these plates will not be assayed for two hybrid interactions at 37 C Colonies from these plates can be used in mating experiments see Yeast Mating of Single Plasmid Transformants If storage of the transformants is desired wrap the plates in Parafilm and store them at 4 C 48 Cytotrap XR Library Construction Kit Examine plates containing transformations 5 8 10 and 11 plated in step 10 of Transforming Yeast and Detecting Protein Protein Interactions and incubated at room temperature and compare the growth at room temperature 22 25 C to that expected see Table V Select at least three colonies from each of these transformations 5 8 10 and 11 for transfer to SD glucose UL and SD galactose UL to test for protein protein interactions that allow growth at 37 C For each colony to be picked aliquot 25 ul of sterile H O to wells of sterile 96 well plates Transfer each colony to be screened to separate wells resuspending the yeast colony in the sterile H O Spot 2 5 ul of the yeast H O suspensions onto each of two SD galactose UL agar plates and two SD glucose UL agar plates Incubate one plate of each type at 37 C Keep the second plate of each type at room temperature 22 25 C for 5 days Score the growth at 37 C after at least 5 days incubation time The SD galactose
92. th methylmercury hydroxide CH3HgOH is recommended see Appendix II Methylmercury Hydroxide Treatment Itis imperative to protect the RNA from any contaminating RNases until the first strand cDNA synthesis is complete Wear fresh gloves use newly autoclaved pipet tips and avoid using pipet tips or microcentrifuge tubes that have been handled without gloves Ribonuclease A cannot be destroyed by normal autoclaving alone Baking or DEPC treatment is recommended e When removing aliquots of any of the enzymes used in the cDNA synthesis protocol flick the bottom of the tube to thoroughly mix the enzyme solution Do not vortex the enzyme stock tubes Cytotrap XR Library Construction Kit Synthesizing First Strand cDNA 1 Prepare water baths at 16 42 and 72 C 2 Thaw the radioactive a 3 2P dNTP do not use P dCTP and all nonenzymatic first strand components Keep the radioactive dNTP on ice for use in step 6 and in the second strand synthesis Briefly vortex and spin down the contents of the nonenzymatic tubes Place the tubes on ice Note AccuScript reverse transcriptase is temperature sensitive and should remain at 20 C until the last moment 3 The final volume of the first strand synthesis reaction is 50 ul The volume of added reagents and enzymes is 14 jl thus the mRNA template and DEPC treated water should be added in a combined volume of 36 ul For the control reaction prepare the following annealing re
93. that permits mutant yeast cdc25H to grow at 37 C Myristylation Signal GDP arget gt RUP Y Ce FiGURE 1 Schematic diagram of the Ras signaling pathway utilized in the CytoTrap two hybrid system BRWN Cytotrap XR Library Construction Kit 5 VECTORS The pSos and pMyr vectors are designed for constructing and expressing gene fusions with the hSos protein and a myristylation signal respectively The pSos vector contains DNA encoding amino acids aa 1 to 1067 of the hSos gene and unique 3 cloning sites It is used for constructing a bait plasmid containing a DNA insert encoding a bait protein The ADH1 promoter driving expression of the hSos bait fusion is constitutively active see Figure 2 The pMyr vector contains DNA encoding the myristylation membrane localization signal Myr and unique 3 cloning sites and is used for constructing plasmids or cDNA libraries that contain DNA inserts encoding target proteins The pMyr XR vector has been digested with EcoR I and Xho I and dephosphorylated with CIAP The GAL1 promoter driving expression of the Myr target fusion is induced by adding galactose to the growth medium Target proteins will be directed to and anchored in the yeast membrane see Figure 3 Both pSos and pMyr vectors contain the pUC and 2p origins for replication in E coli and yeast respectively The pSos and pMyr vectors also carry yeast biosynthetic genes LEU2 and URA3 respective
94. this may affect cDNA separation 4 Once the sample enters the Sepharose CL 2B gel filtration medium fill the connecting tube with buffer using a pipettor Note Do not disturb the bed while filling the connecting tube with buffer Gently add 3 ml of 1x STE buffer to the buffer reservoir by trickling the buffer down the inside wall of the syringe Do not squirt the buffer into the reservoir because this will disturb the resin resulting in loss of the sample 5 Asthe cDNA sample elutes through the column the dye will gradually diffuse as it migrates through the resin Because the dye is used to gauge when the sample elutes from the column monitor the progress of the dye or the cDNA sample could be irretrievably lost Collecting the Sample Fractions The drip column containing the Sepharose CL 2B gel filtration medium separates molecules on the basis of size Large cDNA molecules elute first followed by smaller cDNA and finally unincorporated nucleotides Using a handheld monitor two peaks of radioactivity can generally be detected during the course of elution The first peak to elute from the column represents the cDNA Due to the conditions of label incorporation during second strand synthesis the cDNA is not extremely radioactive therefore the counts per second may be barely above background levels In contrast the second peak to elute from the column is highly radioactive as this is the unincorporated radioactive nucleotides Alth
95. time for yeast colonies to appear Cytotrap XR Library Construction Kit Yeast Mating in Solution Procedure Microtiter Plate Version Aliquot 200 ul of YPAD broth to wells of sterile 96 well plates Pick one colony of the pair of transformants to be mated into the same well See Table VI above for the mating combinations and expected results Incubate the plate on a rotating platform shaker at 220 250 rpm at room temperature 22 25 C for 24 hours Spot 20 ul of each mating culture on two SD glucose UL and two SD galactose CUL agar plates Transfer one plate of each type to 37 C Keep the other plates at room temperature 22 25 C Score the growth at 37 C after at least 5 days incubation time The SD galactose UL agar plates that are incubated at 37 C may require up to 7 10 days incubation time for yeast colonies to appear VERIFYING BAIT PROTEIN EXPRESSION Protein Purification 1 Place 5 ml of SD glucose L media in a 50 ml conical tube Inoculate the medium with a single colony of cdc25H transformed with the pSos bait plasmid 2 Incubate the yeast culture at room temperature 22 25 C with vigorous shaking 250rpm until the culture is saturated 2 3 days until OD o9 gt 1 0 3 Pellet the yeast cells by spinning the culture at 1000 x g for 5 minutes at room temperature 4 Prepare the protein sample using one of the two following protocols Protocol A 1 Resuspend the yeast cell pellet i
96. tive positive colonies of the bait plasmid and mating the cured strains to a naive cdc25H strain harboring the bait plasmid If mating is to be performed prepare cdc25H a strain competent cells and transform them with pSos Col I psos MAFB and the pSos bait construct so that each of these single transformants is available to mate with the pMyr putative positive cDNA clones harbored in the cdc25H a strain If storage of the transformants is desired wrap the plates in Parafilm and store at 4 C Cotransformation and Identification of Putative Positive Interactors 1 Add 40 ug of pSos bait construct 40 ug of pMyr cDNA plasmid library and 200 ul of 1 4 M p mercaptoethanol to 10 ml of freshly prepared cdc25H a yeast competent cells in a 50 ml conical tube 2 Mix the contents thoroughly but gently by inversion to ensure a homogenous mixture 3 Transfer the contents into 20 separate microcentrifuge tubes 4 As a negative control in a separate microcentrifuge tube add 2 ug of pSos plasmid 2 ug of pMyr cDNA plasmid library and 10 ul of 1 4 M p mercaptoethanol to 500 ul of freshly prepared yeast competent cells 5 Incubate the transformation mixtures at room temperature 22 25 C for 30 minutes with occasional mixing 6 Heat shock the transformation mixtures at 42 C for 20 minutes 7 Place the transformation mixtures on ice for 3 minutes 8 Collect the cells by centrifugation for 30 seconds at 14 000 rpm at room temperature
97. trogen b STORAGE CONDITIONS XL10 Gold Kan Ultracompetent Cells 80 C XL10 Gold B Mercaptoethanol Mix 80 C pUC18 DNA Control Plasmid 20 C Vectors 20 C Yeast Strains 80 C Column Reagents 4 C Revision A 01 O Agilent Technologies Inc 2008 Cytotrap XR Library Construction Kit cDNA Synthesis Kit Reagents provided Quantity Storage temperature First strand reagents AccuScript reverse transcriptase AccuScript RT 15 pu 20 C RNase Block Ribonuclease Inhibitor 40 U l 200 U 20 C First strand methyl nucleotide mixture 10 mM dATP dGTP and dTTP 15u 20 C plus 5 mM 5 methyl dCTP First strand buffer 10x 75u 20 C Linker primer 1 4 ng ul 10u 20 C Test poly A RNA 0 2 ug ul 5 ug 20 C Diethylpyrocarbonate DEPC treated water 500 ul 20 C Second strand reagents Second strand buffer 10x 150 ul 20 C Second strand dNTP mixture 10 mM dATP dGTP and dTTP plus 30 ul 20 C 26 mM dCTP Escherichia coli RNase H 1 5 U l 15U 20 C Escherichia coli DNA polymerase 9 0 U l 500 U 20 C Sodium acetate 3 M 250 ul 20 C Blunting reagents Blunting dNTP mixture 2 5 mM dATP dGTP dTTP and dCTP 115 ul 20 C Cloned Pfu DNA polymerase 2 5 U ul 25 U 20 C Ligation reagents EcoR adapters 0 4 ug ul 18 ug 20 C Ligase buffer 10x 250 ul 20 C rATP 10 mM 100 ul 20
98. ull length may decrease The cDNA Synthesis Kit provided with the CytoTrap system has been optimized for 5 ug of mRNA but successful libraries have been generated using the minimums and maximums described here Secondary structure may be a problem with certain RNAs particularly plant and tumor mRNAs These samples can be treated with methylmercury hydroxide see Appendix III Methylmercury Hydroxide Treatment Treatment with methylmercury hydroxide requires heating the RNA to 65 C If the RNA contains even a minute amount of RNase the RNase activity will increase by several orders of magnitude with the increased temperature and significantly degrade the RNA Treatment with methylmercury hydroxide is therefore recommended only if the RNA is free of RNases APPENDIX Ill METHYLMERCURY HYDROXIDE TREATMENT Warning Methylmercury hydroxide is an extremely toxic chemical Wear gloves and use with caution in a fume hood 1 Resuspend the mRNA in 20 ul of DEPC treated water 2 Incubate at 65 C for 5 minutes 3 Cool to room temperature 4 Add2 ul of 100 mM CH HgOH 5 Incubate at room temperature for 1 minute 6 Add 4 ul of 700 mM p mercaptoethanol 7 Incubate at room temperature for 5 minutes 64 Cytotrap XR Library Construction Kit APPENDIX IV ALKALINE AGAROSE GELS Alkaline agarose gels cause DNA to denature and can be used to identify the presence of a secondary structure called hairpinning Hairpinning can occur
99. v 9 47 58 Melcher K and Johnston S 1995 Mol Cell Biol 15 2839 2848 Pabo C O et al 1979 Proc Natl Acad Sci USA 76 1608 1612 Ptashne M et al 1976 Science 194 156 161 Quilliam L A et al 1995 BioEssays 17 395 404 Reece K S and Phillips G J 1995 Gene 165 141 142 Robinson L J et al 1987 Science 235 1218 1221 Swaffield J C et al 1992 Nature London 374 88 91 Thevelein J M 1991 Mol Microbiol 5 1301 1307 Harper J W et al 1993 Cell 75 805 816 76 Cytotrap XR Library Construction Kit ENDNOTES B D Luer Lok and PrecisionGlide are registered trademarks of Becton Dickinson and Company Bacto is a registered trademark of Difco Laboratories Parafilm is a registered trademark of American Can Company SeaPrep is a registered trademark of FMC Corporation Sepharose is a registered trademark of Pharmacia Biotech AB Styrofoam is a registered trademark of Dow Chemical Co Triton is a registered trademark of Rohm and Haas Co VWhRbrand is a trademark of VWR Scientific Whatman is a registered trademark of Whatman Ltd MSDS INFORMATION The Material Safety Data Sheet MSDS information for Stratagene products is provided on the web at http www stratagene com MSDS Simply enter the catalog number to retrieve any associated MSDS s in a print ready format MSDS documents are not included with product shipments Cytotrap XR Lib
100. ve to yeast cotransformations Method A Yeast Cotransformation Isolation of pMyr cDNA Plasmid DNA from Yeast Plasmid DNA can be isolated from yeast in sufficient quality and quantity to transform E coli by the following procedure This procedure yields a mixture of intact plasmid DNA and fragmented chromosomal DNA therefore the resultant plasmid DNA is not of sufficient purity for gel analysis 1 Inoculate 5 ml of SD glucose UL media in a 50 ml conical tube with each of the putative positive clones 2 Incubate the culture at room temperature 22 25 C with vigorous shaking 7250 rpm until the culture is saturated 2 3 days OD o9 gt 1 0 3 Pellet the yeast culture at 1000 x g for 5 minutes at room temperature 4 Resuspend the yeast pellet in 0 3 ml of Yeast Lysis Solution for DNA Isolation see Preparation of Media and Reagents 5 Transfer the suspension to a 1 5 ml microcentrifuge tube 6 Add 50 ul of acid washed glass beads 0 5 mm and 300 ul of phenol chloroform to the microcentrifuge tubes 7 Vortex vigorously for one minute 8 Spin the suspension at 14 000 x g for 5 minutes at room temperature 9 Transfer the top aqueous phase containing the DNA to a new microcentrifuge tube 10 Precipitate the DNA with 600 ul of 100 v v ice cold ethanol at 20 C overnight or at 80 C for 15 minutes 11 Spin the suspension at 14 000 x g for 10 minutes at 4 C 12 Decant the supernatant 13 Wash the DNA
101. way The cdc25 mutation present in the cdc25H strain prevents growth at 37 C but allows normal growth at the permissive temperature 25 C The CytoTrap system is based on the ability of the human Sos protein hSos to complement the cdc25 defect and to activate the yeast Ras signaling pathway Expression of hSos and its subsequent localization to the plasma membrane allows the cdc25H yeast strain to grow at 37 C The localization of hSos to the plasma membrane occurs through the interaction of two hybrid proteins DNA encoding the protein of interest bait protein is cloned into the pSos vector MCS generating a fusion protein of hSos and the bait protein DNA encoding another protein of interest target protein or an expression library is cloned into the pMyr vector MCS and expressed as a fusion protein with a myristylation sequence that anchors the fusion protein to the plasma membrane These fusion proteins are coexpressed in the cdc25H yeast strain and the yeast cells are incubated at the restrictive temperature of 37 C If the bait and target proteins physically interact the hSos protein is recruited to the membrane thereby activating the Ras signaling pathway and allowing the cdc25H yeast strain to grow at 37 C Cell Membrane Target protein becomes anchored to cell membrane Bait protein binds to target localizing hSos to membrane hSos activates RAS by promoting GDP GTP exchange RAS activates signaling cascade
102. xpresses the myristylation signal fused to human lamin C aa 67 230 pSos MAFB expresses the Sos protein and full length MAFB as a hybrid protein The pMyr MAFB control plasmid expresses a hybrid protein that contains the myristylation signal fused to full length MAFB The pMyr SB control plasmid expresses the myristylation signal fused to a Sos binding protein Table II provides a summary of the features of each control plasmid TABLE l Description of Control Plasmids Control plasmid Insert description Genotype pSos Col I Murine 72 kDa type IV LEU2 Amp collagenase aa 148 357 pMyr Lamin C Human Lamin C aa 67 230 URAS Cam pSos MAFB Full length MAFB LEU2 Amp pMyr MAFB Full length MAFB URA3 Cam pMyr SB Sos binding protein URA3 Cam Negative Controls PGALI IT lamin C Flori TCC hSOS pUC ori pSos Col I pMyr Lamin C 11 9 kb collagenase 6 5 kb 2 micron ori i 1 x P chlorampenico i l pUC ori v ampicillin URA3 FiGURE 4 Circular maps of the pSos Col and pMyr Lamin C control plasmids Cytotrap XR Library Construction Kit Positive Controls P ADHI hSOS 2 micron orix pSos MAFB Loi MAFB i HE 12 1 kb 2 micron ori 6 9 kb s ho TADHI lt y a LEU2 4 NS s p N P chloramphenicol La pUC ori l E ampicillin as i rmyr MGAL Sos binding protein fl ori du TCYCI pMyr SB 2 micron ori 7 1 kb pUC ori X d p
103. y result in a loss of efficiency Ultracompetent cells should be placed at 80 C directly from the dry ice shipping container When aliquoting keep ultracompetent cells on ice at all times It is essential that the 14 ml BD Falcon polypropylene round bottom tubes are placed on ice before the cells are thawed and that the cells are aliquoted directly into the prechilled tubes It is also important to use at least 100 gl of ultracompetent cells transformation Using a smaller volume will result in lower efficiencies Use of 14 ml BD Falcon polypropylene tubes It is important that 14 ml BD Falcon polypropylene round bottom tubes are used for the transformation protocol since other tubes may be degraded by the XL10 Gold B ME used in step 3 of Transforming XL10 Gold Cells with the pMyr cDNA Library In addition the incubation period during the heat pulse step is critical and has been calculated for the thickness and shape of the 14 ml BD Falcon polypropylene tube Use of p Mercaptoethanol p Mercaptoethanol D ME has been shown to increase transformation efficiency The XL10 Gold B mercaptoethanol mix provided in this kit is diluted and ready to use For optimum efficiency use 4 ul of the B ME mix Using an alternative source of B ME may reduce transformation efficiency Do not use XL10 Gold B ME mix for the preparation of yeast competent cells Length of the Heat Pulse There is a defined window of highest efficiency resulting from the

CytoTrap XR Library Construction Kit INSTRUCTION MANUAL

Contents

Download Pdf Manuals

Related Search

Related Contents