STRATAGENE StrataClone Ultra Blunt PCR Cloning Kit INSTRUCTION MANUAL
Contents
1. Observation Gel analysis reveals low amounts of PCR product Suggestion The PCR reaction may need to be optimized for specific targets See Table I Optimization Parameters in the Preprotocol Considerations section for a list of optimization parameters and good starting points for various template types Verify that the correct PCR cycling program was chosen based on the size and nature of the template DNA and on the type of temperature cycler used Use the recommended amount of DNA template Excess template can reduce PCR product yield Use intact and highly purified template Lower the annealing temperature in 5 C increments Use a high quality dNTP mix to supply a final concentration of 2250 uM each dNTP Ensure that 10x PfuUltra ll fusion HS DNA polymerase buffer is used Remove extraneous salts from the PCR primers and DNA preparations Use higher denaturing temperatures 98 for GC rich targets lt 10 kb Use the recommended primer concentrations between 0 2 and 0 4 uM Use high quality primers Check the melting temperature purity GC content and length of the primers Consider using PCR adjuncts e g 1 2 U of Perfect Match PCR enhancer Longer denaturation times may damage the DNA template use the shortest denaturation time compatible with successful PCR on the thermal cycler Use thin walled PCR tubes These PCR tubes permit more efficient heat transfer and maximize the2. 95 C 2 minutes 2 30 95 C 20 seconds Primer T 5 Cs 20 seconds 72 C 15 seconds for targets lt 1 kb 15 seconds per kb for targets gt 1 kb 3 1 72 3 minutes B Targets gt 10 kb Vector or Genomic DNA Segment Number of Temperature Duration cycles 1 1 92 C 2 minutes 2 30 92 C 10 seconds Primer 5 Cs 20 seconds 68 C 30 seconds per kb 3 1 68 5 minutes C cDNA Targets Segment Number of Temperature Duration cycles 1 1 95 C minute 2 40 95 C 20 seconds Primer T 5 Cs 20 seconds 72 30 seconds for targets lt 1 kb 30 seconds per kb for targets gt 1 kb 3 1 72 3 minutes Thin walled PCR tubes are highly recommended ensure more efficient heat transfer and to maximize thermal cycling performance These PCR tubes are optimized to Denaturing temperatures above 95 are recommended only for GC rich templates The annealing temperature may require optimization Typically annealing temperatures will range between 55 and 72 10 StrataClone Ultra Blunt PCR Cloning Kit TABLE 111 PCR Cycling Program for Stratagene RoboCycler Temperature Cycler Segment Number of Temperature Duration cycles 95 C minute 2 30 95 C 30 seconds Primer 5 C 30 seconds 72 40 seconds for targets lt 1 kb 40 seconds plus 20 seconds per kb for targets gt 1 3 1 72 5 minutes Thin walled PCR tubes are highly reco
3. QUICK REFERENCE PROTOCOL Prepare insert DNA by PCR using PfuUltra Il Fusion HS DNA Polymerase Add the components in order into sterile thin walled PCR tubes while mixing gently 10 ui Perform PCR using optimized cycling conditions Suggested cycling parameters for typical targets using single block temperature cyclers are shown below See the Protocols section of the manual for PCR cycling parameters optimized for cDNA targets or longer targets Amplification of 10 kb Targets using a Single Block Thermal Cycler Segment Number of cycles Temperature Duration 1 1 95 2 minutes 2 30 95 20 seconds Primer 5 C 20 seconds 72 15 seconds for targets lt 1 kb 15 seconds per kb for targets gt 1 kb 3 1 72 3 minutes Analyze an aliquot of the PCR reaction on an agarose gel to verify production of the expected fragment Prepare the ligation reaction mixture by combining the following components Add the components in the order given below and mix gently by repeated pipetting 3 ul StrataClone Blunt Cloning Buffer 2 ul of PCR product 5 50 ng typically a 1 10 dilution of a robust PCR reaction 1 ul StrataClone Blunt Vector Mix Incubate at room temperature for 5 minutes then place the reaction on ice Add 1 ul of the cloning reaction mixture to a tube of thawed StrataClone SoloPack Competent Cells Mix gently do not mix by repeated pipetting Incubate the transformatio
4. gt mutant loxP derived sequence lox66 71 nonfunctional in Cre mediated 2690 2723 recombination pUC origin of replication 3264 3931 lac promoter 4153 4272 FIGURE 2 StrataClone blunt PCR cloning vector pSC B amp kan The circular map shown represents the product of topoisomerase l mediated ligation of the supplied vector arms to a PCR product of interest followed by Cre mediated recombination The complete sequence and list of restriction sites are available at www stratagene com 6 StrataClone Ultra Blunt PCR Cloning Kit PREPROTOCOL CONSIDERATIONS PCR Primer Design No specific primers are required for the StrataClone Ultra blunt PCR cloning system Cloning efficiency is optimized however by implementing the following primer design considerations e Avoid including the sequences C TCCTT or AAGGG A in the PCR primers The presence of one of these sequences in the primer creates a topoisomerase I binding site CCCTT or TCCTT in the PCR product e The nucleotide composition of the 5 end of the primers influences the cloning efficiency Where possible consider initiating PCR primers with the sequence 5 GG Improved cloning efficiencies have been observed for PCR products containing the sequence 5 GG Avoid including a C residue at position 2 of the PCR primer Reduced cloning efficiencies have been observed for PCR products containing the sequence 5 NC e Do not phosphorylate the 5 ends of PC
5. positive electrode insufficient DNA was loaded It is possible to stain the crystal violet containing gel with ethidium bromide to visualize less abundant DNA species Gel Isolation Protocol The following protocol uses the StrataPrep DNA Gel Extraction Kit Catalog 400766 for recovery of PCR products from a conventional 1 agarose gel TAE or TBE Other gel isolation protocols may also be used l After performing PCR electrophorese the entire PCR reaction typically 50 ul on a 1 agarose gel TAE or TBE buffer 2 For conventional agarose gels prepared without crystal violet stain the gel with ethidium bromide and visualize the PCR products under UV light For crystal violet containing gels the PCR product s should appear as a thin purple band visible under ambient light 3 Excise the gel segment containing the fragment of interest and place the gel slice s in a 1 5 ml microcentrifuge tube Estimate the total volume of the gel slice s A gel slice with dimensions of 0 8 cm x 0 3 cem x 0 5 cm has a volume of 0 12 cm or 120 ul and weighs 120 mg 4 Add 300 ul of DNA extraction buffer for each 100 ul of gel volume or for each 100 mg weight Heat the mixture at 50 C for at least 10 minutes with occasional mixing Be sure that the gel is completely dissolved before continuing to the next step Note For gels with an agarose concentration 22 use 600 ul of DNA extraction buffer for each 100 ul of gel slice volume S
6. 00 31 0 20 312 5700 00800 7001 7001 0800 023 0448 00800 7400 7400 0800 563 080 0800 563 082 0800 563 081 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 917 3282 0800 917 3283 0800 917 3281 All Other Countries Please contact your local distributor A complete list of distributors is available at www stratagene com StrataClone Ultra Blunt PCR Cloning Kit CONTENTS Materials PEO Cl o Ii M RD ER soda 1 Storage Conditions es eei tiere eese Y EE eerte FEES ERU FERRE VERE Rea ue prae Foe ass Pitao E Ue eee Eses assoi S 1 Additional Materials Required eee e eee ee eee eere eee seen eee stans seta setae seen asse ense eese seta 1 A SA 2 Entrod cUo e dioec a 3 Overview of StrataClone Blunt PCR Cloning Technology eee 3 StrataClone SoloPack Competent nennen 5 Map for the StrataClone Blunt PCR Cloning Vector pSC B ampf kan 6 Preprotocol Considerations c ecce ee ee eee e eee eee seen sette sten aee en seen setae seta ases ense eese seta see ea ases eaa 7 PCR Primer D sigh ug aa 7 PCR Reaction Optimization Parameters for PfuUltra II Fusion HS DNA Polymerase 7 Using Plasmid DNA as PCR Template essere nennen nennen nennen 8 Cloning Long PCR Products 5 ean een
7. 2 C 4 Heat shock the transformation mixture at 42 C for 45 seconds 5 Incubate the transformation mixture on ice for 2 minutes 6 Add 250 ul of pre warmed LB medium to the transformation reaction mixture Allow the competent cells to recover for at least 1 hour at 37 with agitation Lay the tube of cells on the shaker horizontally for better aeration Note When selecting transformants on kanamycin plates increasing the recovery period to 1 5 2 hours will increase the number of transformants obtained 7 During the outgrowth period prepare LB ampicillin plates or LB kanamycin plates for blue white color screening by spreading 40 ul of 2 X gal on each plate See Preparation of Media and Reagents StrataClone Ultra Blunt PCR Cloning Kit 8 Plate 5 ul and 100 wl of the transformation mixture on the color screening plates Incubate the plates overnight at 37 C Notes For the Control Insert cloning reaction plate 25 yl of the transformation mixture on LB ampicillin plates For the pUCI8 control transformation plate 30 ul of the transformation mixture on LB ampicillin plates When spreading 50 ul of transformation mixture pipette the cells into a 50 ul pool of LB medium before spreading Analyzing the Transformants l Pick white or light blue colonies for plasmid DNA analysis Do not pick dark blue colonies Notes Colonies harboring plasmids containing typical PCR product inserts are expe
8. 948 663 6 183 997 6 444 428 6 489 150 6 734 293 7 045 328 and patents pending StrataClone Ultra Blunt PCR Cloning Kit Incubate blunt PCR product with Topoisomerase I charged vector arms 5 minutes Topoisomerase Plats lac Z MCS MCS lac Z Topoisomerase y Transform StrataClone competent cells expressing Cre recombinase pUC ori StrataClone PCR Cloning Vector pSC B amp kan lt loxP gt ampicillin kanamycin Figure 1 Overview of the StrataClone blunt PCR cloning method StrataClone Ultra Blunt PCR Cloning Kit StrataClone SoloPack Competent Cells The provided StrataClone SoloPack competent cells express Cre recombinase in order to circularize the linear DNA molecules produced by topoisomerase I mediated ligation The cells are provided in a convenient single tube transformation format This host strain containing the lacZAM15 mutation supports blue white screening with plasmid pSC B containing the lacZ a complementation cassette see Figure 2 It is not necessary to induce lacZ expression with IPTG when performing blue white screening with this strain The StrataClone SoloPack competent cells are optimized for high efficiency transformation and recovery of high quality recombinant DNA The cells are endonuclease endA and recombination recA deficient and are restriction minus The cells lack the tonA receptor conferring resistance to T5 and 80 bacterio
9. R primers Topoisomerase I strictly requires a 5 hydroxyl group as a substrate for the DNA strand joining reaction PCR Reaction Optimization Parameters for PfuUltra 11 Fusion HS DNA Polymerase A basic PCR protocol is provided in the Protocols section This protocol may need to be optimized for your specific target See Table I below for optimization guidelines TABLE 1 OPTIMIZATION PARAMETERS FOR 50 1 REACTION VOLUME Vector or Genomic DNA Vector or Genomic DNA Parameter Targets 10 kb Targets gt 10 kb cDNA Targets Extension time 15 seconds for targets lt 1 kb 30 seconds per kb 30 seconds for targets lt 1 kb 15 seconds per kb for 30 seconds per kb for targets gt 1 kb targets gt 1 kb PfuUltra 11 fusion HS 1 wl 1 ul lul DNA polymerase Input template 100 ng genomic DNA 200 250 ng genomic DNA 1 2 ul c DNA from RT PCR 5 30 ng vector DNA 5 30 ng vector DNA reaction 50 500 ng starting total RNA template 0 2 uM each primer 0 4 uM each primer 0 2 uM each primer dNTP concentration 250 uM each dNTP 500 uM each dNTP 250 uM each dNTP 1 mM total 2 mM total 1 mM total Final reaction buffer 1 0x 1 0x 1 0x concentration Denaturing 95 C 92 C 95 C temperature Extension 72 68 72 temperature StrataClone Ultra Blunt PCR Cloning Kit 7 Using Plasmid DNA as PCR Template Genomic DNA plasmid DNA or cDNA may be used as template for PCR amplification prior to cloning When the templat
10. SOLATION OF PCR PRODUCTS Special Considerations for Long PCR Products The StrataClone blunt PCR cloning kit has been used to clone PCR products up to 9 kb in length When cloning long PCR products it is generally advantageous to gel purify the insert prior to performing the cloning reaction Long PCR products have been successfully cloned after gel purification using conventional ethidium bromide staining In some cases however using crystal violet stain to visualize the DNA may help preserve DNA integrity and increase the cloning efficiency When performing crystal violet staining use the following modifications to the basic protocol below Crystal violet should be added to the melted agarose prepared in 1x TAE buffer to a final concentration of 1 6 ug ml It is not necessary to add crystal violet to the running buffer Prepare 6x loading buffer containing 30 glycerol 20 mM EDTA and 100 ug ml crystal violet Do not use a gel loading buffer containing xylene cyanol or bromophenol blue During electrophoresis the free crystal violet migrates toward the negative electrode or up the gel Continue electrophoresis until the crystal violet front is about 25 of the way up the gel or until the DNA bound crystal violet bands appearing as thin purple lines are sufficiently resolved Crystal violet is less sensitive than ethidium bromide with a detection limit of 200 ng band If you do not see one or more purple bands migrating toward the
11. StrataClone Ultra Blunt PCR Cloning Kit INSTRUCTION MANUAL Catalog 240218 Revision C 02 For In Vitro Use Only 240218 12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product No other warranties of any kind express or implied including without limitation implied warranties of merchantability or fitness for a particular purpose are provided by Agilent Agilent shall have no liability for any direct indirect consequential or incidental damages arising out of the use the results of use or the inability to use this product ORDERING INFORMATION AND TECHNICAL SERVICES United States and Canada Agilent Technologies Stratagene Products Division 11011 North Torrey Pines Road La Jolla CA 92037 Telephone Order Toll Free Technical Services Internet World Wide Web 858 373 6300 800 424 5444 800 894 1304 techservices agilent com www stratagene com Europe Location Telephone Fax Technical Services Austria 0800 292 499 0800 292 496 0800 292 498 Belgium 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 15775 0800 15740 0800 15720 France 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 919 288 0800 919 287 0800 919 289 Germany 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 182 8232 0800 182 8231 0800 182 8234 Netherlands Switzerland United Kingdom 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 023 0446 00800 7000 70
12. advantageous to gel purify the PCR product of interest This reduces the number of white colonies containing inserts other than the desired PCR product A gel purification protocol is provided in Appendix I In addition to gel purification the following minor protocol modifications can facilitate the recovery of clones containing long 23 kb PCR product inserts e When performing PCR implement protocol modifications appropriate for long PCR products including longer extension times See Table I Optimization Parameters for more information e If gel purification is not performed add 2 ul of the undiluted PCR reaction to the cloning reaction in order to increase the molar ratio of insert vector arms e Recovery of inefficiently cloned long inserts may be facilitated by transforming the maximum volume of cloning reaction 2 ul and by spreading larger volumes of the transformation mixture StrataClone Ultra Blunt PCR Cloning Kit PROTOCOLS Preparing the PCR Product 1 Prepare the PCR reaction mixture by adding the components listed below in order into sterile thin walled PCR tubes while mixing gently The table provides an example reaction mixture for the amplification of a typical single copy chromosomal target x10 kb See Table I Optimization Parameters for advice on optimizing PCR for cDNA targets or longer targets The amounts listed are for one reaction and must be adjusted for multiple samples Reaction Mixture
13. ber matrix in the microspin cup Incubate the tube at room temperature for 5 minutes Cap the spin cup and then spin the tube in a microcentrifuge at maximum speed for 30 seconds Retain the microcentrifuge tube containing the purified DNA solution and discard the microspin cup Proceed to step 4 of the Blunt PCR Cloning Protocol and add 2 ul of the purified DNA undiluted to the cloning reaction mixture StrataClone Ultra Blunt PCR Cloning Kit 19 REFERENCES 1 Shuman S 1994 J Biol Chem 269 51 32678 84 2 Abremski K Hoess R and Sternberg N 1983 Cell 32 4 1301 11 3 Turgut Balik D Celik V C Moreton K and Brady R L 2005 Acta Biol Hung 56 3 4 389 97 ENDNOTES Applied Biosystems is a registered trademark of Applera Corporation or its subsidiaries in the US and certain other countries DNA Engine and MJ Research are registered trademarks of Bio Rad Laboratories Inc GeneAmp is a registered trademark of Roche Molecular Systems Inc MSDS INFORMATION The Material Safety Data Sheet MSDS information for Stratagene products is provided on the web at http www stratagene com MSDS Simply enter the catalog number to retrieve any associated MSDS s in a print ready format MSDS documents are not included with product shipments 20 StrataClone Ultra Blunt PCR Cloning Kit STRATAGENE An Agilent Technologies Division StrataClone Ultra Blunt PCR Cloning Kit Catalog 240218
14. cted to be white After prolonged incubation some of the insert containing colonies may appear light blue If the insert contains an in frame start codon proximal to a ribosome binding site a functional LacZ a fragment fusion protein may be produced This typically results in blue or light blue colonies for one insert orientation If large numbers of blue colonies are obtained analyze the DNA from a selection of these colonies for the presence of the insert 2 Prepare miniprep DNA from the selected colonies using standard protocols Perform restriction digestion analysis of the miniprep DNA to identify colonies harboring the desired clone The PCR product insertion site is flanked by EcoR I sites for convenient identification of insert containing plasmids To screen for clones with a specific insert orientation digest the miniprep DNA with a restriction enzyme with a single cleavage site in the insert DNA and one or a small number of sites in the vector DNA Note Alternatively positive clones may be identified by PCR analysis of plasmid DNA using the T3 T7 primer pair or using one primer corresponding to insert sequences and a second primer corresponding to vector MCS sequences StrataClone Ultra Blunt PCR Cloning Kit Expected Results for the Control Insert Transformation After plating 25 ul of the Control Insert transformation reaction gt 100 cfu are expected Greater than 95 of these colonies should be white on agar pla
15. e is a plasmid that encodes the ampicillin resistance gene plate the transformation on kanamycin plates to eliminate carryover of the template plasmid If plating the transformation on ampicillin plates is preferred the resulting ampicillin resistant colonies may be grown up in liquid overnight cultures containing kanamycin to ensure that ampicillin resistance is not derived from a carryover template plasmid Similarly if the template plasmid confers kanamycin resistance plate the transformation mixture on ampicillin plates Note Development of kanamycin resistance in transformants requires more time than development of ampicillin resistance When selecting transformants on kanamycin plates increasing the duration of the outgrowth period in liquid LB prior to plating may increase the number of transformants obtained Cloning Long PCR Products PfuUltra II fusion HS DNA polymerase is optimized for the production of a wide range of target lengths including long PCR products The StrataClone blunt PCR cloning kit has been used to clone PCR products up to 9 kb in length The cloning efficiency varies significantly according to the size and sequence of the PCR product When cloning long PCR products it is especially important to analyze the PCR products on a gel prior to performing the ligation reaction If gel analysis reveals inefficient production of the desired PCR product or reveals the presence of non specific products it is generally
16. e oat eed a aad ene 8 jnn 9 Preparing the PER Product tit d ee eee eee tree 9 Ligating the PCR Product into the StrataClone Blunt Vector Arms 11 Transforming the Competent Cells eese nennen nennen nennen 12 Analyzing the Transformants oooonocnnoccnonononononoconcconnconncnnn nono nonn nono conan ennt nennen 13 Expected Results for the Control Insert Transformation eere 14 Expected Results for the Experimental Insert Transformation eee 14 Expected Results for the pUC18 Control Transformation eee 14 Korn iM R seos Sos 15 Preparation of Media and Reagents 4 eret eee e eerte ee ee ee seen eese s toes tana eee 17 Appendix I Gel Isolation of PCR Products 4 eee e cete ee esee ee eee eee ee sten nest tasse etes etas stanno 18 Special Considerations for Long PCR Products eee 18 Gel Isolation Protocol aca Re Hee ry eie eere ies 18 References E RAR RAR SERI NE RA A ARA 20 jD M 20 MSDS Mii anri Ee 20 StrataClone Ultra Blunt PCR Cloning Kit MATERIALS PROVIDED Materials Provided Quantity PfuUltra 11 Fus
17. en incubate the ligation reaction at room temperature for 5 minutes When the incubation is complete place the reaction on ice Note The cloning reaction may be stored at 20 C for later processing StrataClone Ultra Blunt PCR Cloning Kit 11 Transforming the Competent Cells Note StrataClone Blunt vector arms purchased prior to 2 1 2008 do not carry the kanamycin resistance marker If planning to use kanamycin selection ensure that the cloning reaction was performed using StrataClone Blunt Vector Mix amp kan as listed on the tube label 1 Thaw one tube of StrataClone SoloPack competent cells on ice for each ligation reaction Note It is critical to use the provided StrataClone SoloPack competent cells expressing Cre recombinase for this protocol Do not substitute with another strain 2 Add 1 ul of the cloning reaction mixture to the tube of thawed competent cells Mix gently do not mix by repeated pipetting Notes For large PCR products up to 2 ul of the cloning reaction mixture may be added to the transformation reaction If desired test the transformation efficiency of the competent cells by transforming a separate tube of competent cells with 10 pg of the pUCIG control DNA Prior to use dilute the pUCIS DNA provided 1 10 in dH50 and then add 1 ul of the dilution to the tube of competent cells 3 Incubate the transformation mixture on ice for 20 minutes During the incubation period pre warm LB medium to 4
18. for a Typical Single Copy Chromosomal Locus PCR Amplification lt 10 kb 0 5 ul Primer 2 10 uM PfuUltra II fusion HS DNA polymerase The 10x buffer provides a final 1x Mg concentration of 2 mM The amount of template DNA required varies depending on the type of DNA being amplified Generally 100 ng of genomic DNA is recommended Less template DNA 5 30 ng should be used for amplification of lambda or plasmid PCR targets Use 1 2 ul of cDNA prepared from an RT PCR reaction containing 50 500 ng total RNA and adjust the amount of dH O accordingly 2 Perform PCR using optimized cycling conditions Suggested cycling parameters for using single block temperature cyclers Table and the Stratagene RoboCycler temperature cyclers Table are indicated on the following page The PCR cycling parameters for single block temperature cyclers have been tested on the following instruments the MJ Research DNA Engine PTC 200 the Applied Biosystems GeneAmp PCR system 9700 the Applied Biosystems GeneAmp PCR system 9600 and the Stratagene Mx3000P QPCR system Optimized cycling parameters are not necessarily transferable between thermal cyclers StrataClone Ultra Blunt PCR Cloning Kit 9 TABLE Il PCR Cycling Programs for Single Block Temperature Cyclers A Targets lt 10 kb Vector or Genomic DNA Segment Number of Temperature Duration cycles 1 1
19. ion HS DNA Polymerase 40 PCR reactions 10x PfuUltra 11 Reaction Buffer 1 ml StrataClone Blunt Vector Mix amp kan 21 cloning reactions 1 ul each StrataClone Blunt Cloning Buffer 63 pl StrataClone Blunt Control Insert 5 ng tl 50 ng StrataClone SoloPack Competent Cells 21 transformations 50 ul each pUC18 Control Plasmid 0 1 ng ul in TE buffer 10 ul Catalog 240218 provides enough reagents for 40 x 50 ul PCR reactions and for 20 experimental cloning reactions plus one Control Insert cloning reaction STORAGE CONDITIONS StrataClone SoloPack Competent Cells and pUC18 Control Plasmid 80 C All Other Components Prior to first use store at 80 C After thawing store at 20 C Note The StrataClone SoloPack Competent Cells are sensitive to variations in temperature and must be stored at the bottom of a 80 C freezer Transferring tubes from one freezer to another may result in a loss of efficiency ADDITIONAL MATERIALS REQUIRED Thermocycler LB ampicillin or LB kanamycin agar plates LB medium 5 Bromo 4 chloro 3 indoyl P D galactopyranoside X gal Preparation of Media and Reagents Revision C 02 O Agilent Technologies Inc 2008 StrataClone Ultra Blunt PCR Cloning Kit 1 NOTICES TO PURCHASER Limited Label License for StrataClone Ultra Blunt PCR Cloning Kits US Patent No 7 109 178 and patents pending Purchase of this product conveys to the purchaser only the non transferable right under these paten
20. ix I Redesign primers and or optimize the PCR reaction to maximize the specificity of the PCR amplification for the amplicon of interest Verify the specific amplification of the product of interest on an agarose gel The cloning efficiency of PCR products varies greatly according to the size and sequence of the amplicon For PCR products that are refractory to cloning it may be necessary to gel purify the PCR product of interest to remove minor contaminants that are preferentially ligated in the blunt PCR cloning reaction or that are better tolerated in E coli Low ratio of insert containing vectors to empty vectors Primer sequence composition can affect cloning efficiency Follow the guidelines in PCR Primer Design in the Preprotocol Considerations section The insert may be toxic to E coli or contain secondary structures that interfere with cloning Table continues on the following page 16 StrataClone Ultra Blunt PCR Cloning Kit Table continues from the previous page Plasmids recovered from white colonies do not have the expected restriction pattern for Ampicillin or kanamycin resistant plasmids may be carried over from the PCR reaction If a plasmid containing the ampicillin resistance gene was used as the PCR template plate the transformation on kanamycin containing plates pSC B Conversely if a plasmid containing the kanamycin resistance gene was used as the PCR template p
21. late the transformation on ampicillin containing plates Alternatively template plasmid may be removed from the cloning reaction by either gel purification of the insert of interest or by treating the final PCR product with restriction enzyme Cloning an insert that is toxic to E coli can result in selection for plasmids with large deletions or other mutations that affect the restriction pattern PREPARATION OF MEDIA AND REAGENTS LB Agar per Liter 10 g of NaCl 10 g of tryptone 5 g of yeast extract 20 g of agar Add deionized H O to a final volume of liter Adjust pH to 7 0 with 5 N NaOH Autoclave Pour into petri dishes 25 ml 100 mm plate LB Broth per Liter 10 g of NaCl 10 g of tryptone 5 g of yeast extract Add deionized H O to a final volume of liter Adjust pH to 7 0 with 5 N NaOH Autoclave LB Ampicillin Agar per Liter liter of LB agar autoclaved Cool to 55 Add 10 ml of 10 mg ml filter sterilized ampicillin Pour into petri dishes 25 ml 100 mm plate liter of LB agar autoclaved Cool to 55 Add 2 5 ml of 20 mg ml filter sterilized kanamycin Pour into petri dishes 25 ml 100 mm plate LB Kanamycin Agar per Liter 2 X Gal per 10 ml 0 2 g of 5 bromo 4 chloro 3 inodlyl D D galactopyranoside X Gal 10 ml of dimethylformamide DMF Store at 20 C Spread 40 per LB agar plate StrataClone Ultra Blunt PCR Cloning Kit APPENDIX I GEL I
22. mmended These PCR tubes are optimized to ensure more efficient heat transfer and to maximize thermal cycling performance gt The annealing temperature may require optimization Typical annealing temperatures will range between 55 and 72 For genomic and vector targets gt 10 kb use an extension time of 30 seconds per kb and use an extension temperature of 68 3 Analyze an aliquot of the PCR reaction on an agarose gel to verify production of the expected fragment 4 If the fragment to be cloned is 3 kb and gel analysis confirms robust specific amplification prepare a 1 10 dilution of the PCR reaction in dH 0 For larger or poorly amplified fragments omit the dilution step Note If multiple PCR products are observed on the gel or when cloning very large PCR products gel isolate the desired PCR product prior to performing the ligation reaction See Appendix I for a gel isolation protocol For a gel isolated PCR product recovered in 50 ul add 2 ul undiluted of the purified PCR product to the ligation reaction below Ligating the PCR Product into the StrataClone Blunt Vector Arms 1 Prepare the ligation reaction mixture by combining in order the following components 3 ul StrataClone Blunt Cloning Buffer 2 ul of PCR product 5 30 ng typically a 1 10 dilution of a robust PCR reaction or 2 ul of StrataClone Control Insert 1 ul StrataClone Blunt Vector Mix amp kan 2 Mix gently by repeated pipetting and th
23. n mixture on ice for 20 minutes Heat shock the transformation mixture at 42 C for 45 seconds Incubate the transformation mixture on ice for 2 minutes Add 250 ul of LB medium pre warmed to 42 Allow the cells to recover at 37 with agitation for at least 1 hour incubate for 1 5 2 hours before plating on kanamycin plates Plate 5 ul and 100 ul of the transformation mixture on LB ampicillin or LB kanamycin plates that have been spread with 40 ul of 2 X gal Incubate the plates overnight at 37 Pick white or light blue colonies for plasmid DNA analysis Do not pick dark blue colonies Prepare miniprep DNA from the selected colonies Identify plasmids containing the PCR product insert and determine insert orientation by restriction analysis
24. phage infection and lack the F episome StrataClone SoloPack competent cells are resistant to streptomycin StrataClone Ultra Blunt PCR Cloning Kit 9 Map for the StrataClone Blunt PCR Cloning Vector pSC B amp kan MCS Blunt PCR Product Insertion Site lacZ P lac pUC A kanamycin pSC B amp kan 4 3 kb A A lt loxP gt i gt 4 Ho i p Lampicillin pSC B amp kan Blunt PCR Cloning Vector PCR Product Insertion Site Region sequence shown 4263 4272 1 252 41 Apa Hinc Il Y a fragment EcoO109 I Acc 1 p seni Dra Il Xho Sall GGAAACAGCTATGACCATGATTACGCCAAGCGC GCAATTAACCCTCACTAAAGGGARCAAA AGCTGGGTACCGGGCCCC CCCTCGAGGT CGAC oe M13 Reverse primer binding site T3 primer binding site Bsp1 061 Clal Hind lll EcoR non unique EcoR non unique Pst Sma GGTATCGATAAGCTTGATATCCACTGTGGAATTCGCCCTT PCR Product AAGGGCGAATTCCACATTGGTCGCTGCAGCCCGGG BamHI Spel Xba Not Sac Il Sac T GGATCCACTAG TTCTAGAGCGGCCGCACCG CGGGAGCTC CAATTCGCCCTATAGTGAGTCGTATTAC GCGCGCTCACTGGCCGTCGTTTTACAA T7 primer binding site 113 20 primer binding site Feature Nucleotide Position B galactosidase a fragment coding sequence lacZ 1 354 Multiple cloning site MCS 57 197 PCR product insertion site 123 kanamycin resistance ORF 465 1256 ampicillin resistance bla ORF 1268 2125 origin of ss DNA replication 2317 2623 lt loxP
25. rey Pines Road La Jolla California 92037 Phone 858 373 6300 Notice to Purchaser Limited License Purchase of this product includes an immunity from suit under patents specified in the product insert to use only the amount purchased for the purchaser s own internal research No other patent rights such as 5 Nuclease Process patent rights are conveyed expressly by implication or by estoppel Further information on purchasing licenses may be obtained by contacting the Director of Licensing Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 USA 2 StrataClone Ultra Blunt PCR Cloning Kit INTRODUCTION The StrataClone Ultra Blunt PCR Cloning Kit couples highest accuracy PCR amplification with easy robust topoisomerase based PCR cloning The kit includes PfuUltra II Fusion HS DNA Polymerase which provides the highest fidelity PCR and excellent reliability while dramatically reducing overall PCR extension times The blunt end cloning vector mix uses our StrataClone DNA topoisomerase I technology with simple primer design no PCR clean up and an easy three step process Overview of StrataClone Blunt PCR Cloning Technology Using the method summarized in Figure 1 StrataClone blunt PCR cloning technology exploits the combined activities of topoisomerase I from Vaccinia virus and Cre recombinase from bacteriophage P1 In vivo DNA topoisomerase I assists in DNA replication by relaxing and rejoining DNA s
26. rmal cycling performance Multiple bands produced from Increase the annealing temperature in 5 C increments PCR reaction Use Perfect Match PCR enhancer to improve PCR product specificity Artifactual smears produced Decrease the amount of PfuUltra Il fusion HS DNA polymerase from PCR reaction Low colony numbers obtained from the cloning procedure all Reduce the extension time utilized Verify that the PCR primer design considerations outlined in Preprotocol Considerations were implemented insert sizes Verify that the PCR reaction produced a sufficient amount of the PCR product of interest by analyzing an aliquot on an agarose gel Perform a control cloning reaction using the Control Insert provided to verify that all of the kit reagents are working properly Titrate the amount of PCR product added to the blunt PCR cloning reaction For most inserts lt 3 kb using 2 ul of a 1 10 dilution of the PCR reaction will produce plenty of colonies In some cases however adding a greater amount of insert will increase the number of colonies recovered Conversely adding an excess of the PCR reaction may inhibit the cloning reaction Increase the amount of the cloning reaction mixture added to the transformation reaction to 2 pl Increase the amount of the transformation reaction plated e g plate 100 ul and 200 ul of the transformation reaction mixture Perform the transformation cont
27. rol reaction with pUC18 DNA to verify the expected transformation efficiency of the competent cells Verify that the StrataClone SoloPack competent cells provided with the kit were used for transformation Other competent cells lack the Cre recombinase required for production of the pSC B plasmid from the vector arms Table continues on the following page StrataClone Ultra Blunt PCR Cloning Kit 15 Table continues from the previous page Low colony numbers obtained when using kanamycin selection marker all insert sizes When selecting transformants using kanamycin resistance allow the cells to recover in liquid LB medium for up to 2 hours prior to plating on LB kanamycin plates See Preprotocol Considerations for more information Low colony numbers large inserts Gel purify the PCR product prior to performing the cloning reaction see Appendix 1 Using crystal violet stain to visualize the PCR product may help preserve the integrity of long PCR products during isolation Increase the amount of the cloning reaction mixture added to the transformation reaction to 2 ul Increase the amount of the transformation reaction plated e g plate 100 pl and 200 ul of the transformation reaction mixture Verify that PCR conditions including extension time are appropriate for long PCR products Greater than expected ratio of blue white colonies for the experimental insert If the insert contain
28. s an ATG start codon in frame with the lacZ gene a functional LacZ fusion protein may be produced This typically results in blue or light blue colonies for one insert orientation and white colonies for the other orientation Analyze the DNA from some of the blue colonies for the presence of the insert Non specific PCR products may be preferentially cloned and those that produce an in frame fusion with LacZ may convey a blue phenotype Spread a greater quantity of the transformation reaction and then select the white colonies or gel purity the PCR product of interest prior to performing the cloning reaction see Appendix I The blue phenotype may be caused by transformation of a LacZ expressing plasmid carried over from the PCR reaction If a plasmid containing the ampicillin resistance gene was used as the PCR template plate the transformation on kanamycin containing plates Conversely if a plasmid containing the kanamycin resistance gene was used as the PCR template plate the transformation on ampicillin containing plates Alternatively template plasmid may be removed from the cloning reaction by either gel purification of the insert of interest or by treating the final PCR product with restriction enzyme Dpn 1 Low recovery of vectors containing the insert of interest Analyze an aliquot of the PCR reaction on an agarose gel If a single discrete band is not observed gel purify the PCR product of interest see Append
29. tes containing X gal Plasmid DNA prepared from gt 95 of the white colonies should contain the 659 bp Control Insert DNA The presence of the Control Insert is easily verified by digestion of miniprep DNA with Pvu II restriction enzyme DNA fragments expected from Pvu II digestion of plasmids containing the Control Insert are 3090 1140 and 701 bp Plasmids lacking insert DNA are expected to produce Pvu II fragments of 3090 701 and 481 bp Note Analysis for the presence of the Control Insert using EcoR I digestion is not recommended because the Control Insert contains an EcoR I restriction site Expected Results for the Experimental Insert Transformation The number of colonies obtained and the cloning efficiency depend upon the size amount sequence and purity of the PCR product used for ligation For typical PCR products the standard protocol produces hundreds of colonies for analysis Cloning large or challenging inserts may benefit from some minor protocol alterations discussed in Preprotocol Considerations and Troubleshooting Expected Results for the pUC18 Control Transformation If transformation of the pUC18 control plasmid was performed 250 colonies should be observed indicating a transformation efficiency gt 5 x 107 cfu ug pUC18 DNA Virtually all of these colonies will be blue on plates containing X gal since pUC18 contains the intact lacZ gene cassette StrataClone Ultra Blunt PCR Cloning Kit TROUBLESHOOTING
30. trands Topoisomerase I cleaves the phosphodiester backbone of a DNA strand after the sequence 5 CCCTT forming a covalent DNA enzyme intermediate which conserves bond energy to be used for religating the cleaved DNA back to the original strand Once the covalent DNA enzyme intermediate is formed the religation reaction can also occur with a heterologous DNA acceptor The Cre recombinase enzyme catalyzes recombination between two loxP recognition sequences The StrataClone blunt PCR cloning vector mix contains two blunt ended DNA arms each charged with topoisomerase I on one end and containing a loxP recognition sequence on the other end Blunt ended PCR products produced by proofreading PCR enzymes are efficiently ligated to these vector arms in a 5 minute ligation reaction by topoisomerase I mediated strand ligation The resulting linear molecule vector arm PCR product vector is then transformed with no clean up steps required into a competent cell line engineered to transiently express Cre recombinase Cre mediated recombination between the vector loxP sites creates a circular DNA molecule pSC B amp kan see Figure 2 that is proficient for replication in cells growing on media containing ampicillin or kanamycin The resulting pSC B amp kan vector product includes a lacZ a complementation cassette for blue white screening US Patent No 7 109 178 and patents pending U S Patent Nos 5 545 552 5 866 395 5
31. trataClone Ultra Blunt PCR Cloning Kit 10 12 13 14 15 16 17 18 Seat a microspin cup provided with the StrataPrep DNA gel extraction kit in a 2 ml receptacle tube Transfer the gel extraction mixture to the spin cup exercising caution to avoid damaging the fiber matrix Cap the spin cup and then spin the tube in a microcentrifuge at maximum speed for 30 seconds Note The DNA is retained in the fiber matrix of the microspin cup The binding capacity of the microspin cup is 10 ug Retain the microspin cup and discard the liquid filtrate in the tube Replace the microspin cup in the 2 ml receptacle tube Prepare the 1x wash buffer provided with the StrataPrep DNA gel extraction kit by adding an equal volume of 100 ethanol to the container of 2x wash buffer Store the 1x wash buffer at room temperature Add 750 ul of 1x wash buffer to the microspin cup Cap the spin cup and then spin the tube in a microcentrifuge at maximum speed for 30 seconds Retain the microspin cup and discard the wash buffer Place the microspin cup back in the 2 ml receptacle tube Cap the spin cup and then spin the tube in a microcentrifuge at maximum speed for 30 seconds After spinning verify that all of the wash buffer is removed from the microspin cup Transfer the microspin cup to a fresh 1 5 ml microcentrifuge tube and discard the 2 ml receptacle tube Add 50 ul of elution buffer or dH O directly onto the fi
32. ts to use the product for research use only by the purchaser No rights are granted to the purchaser hereunder to sell modify for resale or otherwise transfer this product either alone or as a component of another product to any third party Agilent reserves all other rights and this product may not be used in any manner other than as provided herein For information on obtaining a license to use this product for purposes other than research please contact Stratagene Products Division Business Development 11011 North Torrey Pines Road La Jolla California 92037 Phone 858 373 6300 Limited Label License for Pfu Containing DNA Polymerase Products This product is covered by the claims of one or more of the following U S Patents 5 545 552 5 556 772 5 866 395 5 948 663 6 489 150 6 183 997 6 333 165 6 379 553 6 444 428 Purchase of this product conveys to the purchaser only the non transferable right under these patents to use the product for research use only by the purchaser No rights are granted to the purchaser hereunder to sell modify for resale or otherwise transfer this product either alone or as a component of another product to any third party Agilent reserves all other rights and this product may not be used in any manner other than as provided herein For information on obtaining a license to use this product for purposes other than research please contact Stratagene Products Division Business Development 11011 North Tor
Download Pdf Manuals
Related Search
STRATAGENE StrataClone Ultra Blunt PCR Cloning Kit INSTRUCTION MANUAL