Home

Agilent pCMV-Tag 1 Epitope Tagging Mammalian Expression Vector Instruction Manual

Contents

1. Kozak Gene Stop Stop A TS MCS 1 Kozak FLAG codon MCS 2 c myc codon K Bel Il Gene B T3 MCS 1 Kozak dow MCS 2 all IK FLAG Codon c Myc Codon lt Bgl II Gene Stop Stop C 3 MCS 1 Kozak FLAG Codon MCS 2 c myc Codon VA Bgl Il Kozak Gene T3 7 Stop 7G 2 Stop T7 D 19 MCS 1 Kozak FLAG oan MCS 2 cmyc San g Bgl Il 5 portion Gene 3 portion Gene T3 Stop Stop T7 E T3 MCS 1 Kozak FLAG out MCS 2 c myc codon lt Bgl I Kozak Gene Termination Stop Stop F T3 MCS 1 Kozak FLAG asn MCS 2 myc Codon LZ FLAG C terminus FLAG N terminus FLAG amp c myc N amp C termini c myc C terminus FLAG Internal No Tag FIGURE 3 Cloning strategies for epitope tagging in the pCMV Tag 1 vector pCMV Tag 1 Epitope Tagging Mammalian Expression Vector PREPARATION OF HOST STRAINS Bacterial Host Strain The XL1 Blue host strain has been sent as a bacterial glycerol stock For the appropriate media please refer to the following table Agar for bacterial streak Medium for bacterial glycerol stock LB tetracycline LB tetracy
2. In addition to the epitope tag sequences the pCMV Tag 1 vector contains features for expression of fusion proteins in eukaryotic cells The cytomegalovirus CMV promoter allows constitutive expression of the cloned DNA in a wide variety of mammalian cell lines The neomycin resistance gene is under control of both the prokaryotic B lactamase promoter to provide kanamycin resistance in bacteria and the SV40 early promoter to provide G418 resistance in mammalian cells The multiple cloning site MCS of the pCMV Tag 1 vector allows a variety of cloning strategies resulting in C terminal N terminal or internal tagging see Figure 2 A Kozak consensus sequence provides optimal expression of the fusion protein when the N terminal FLAG epitope is used Other cloning options which require fusion proteins to include their own translational start sequence are also possible pCMV Tag 1 Epitope Tagging Mammalian Expression Vector 3 pCMV Tag 1 Vector Map pUC ori FLAG MCS2 y myc TK pA pCMV Tag1 DARA 4 3 kb gt LA ori neo kan i P bla pCMV Tag 1 Multiple Cloning Site Region pone sequence shown 620 840 Sac Not T3 promoter A ATT AAC CCT CAC TAA AGG GAA CAA AAG CTG GAG CTC CAC CGC GGT GGC GGC CGC TCT A Bgl Il FLAG t Sel BamH G tag M D Y K D D D D KI GC CCG GGC GGA TCC ACC ATG GAT TAC AAG GAT GAC GAC GAT AAG ATC TGA TCA GAT STOP KOZAK EcoR V Hind Il Acc I Sal Xho rav
3. dNTP mix 25 mM each dNTP 40 0 ng of T3 primer 40 0 ng of T7 primer 0 4 ul of 10 v v Tween 20 1 0 U of Tag DNA polymerase dH O to a final volume of 40 ul Vector Primer Binds to Nucleotide sequence 5 to 3 nucleotide nt pCMV Tag 1 T3 620 639 AATTAACCCTCACTAAAGGG vector T7 799 778 GTAATACGACTCACTATAGGGC 2 Stab the transformed colonies with a sterile toothpick and swirl the colony into reaction tubes Immediately following inoculation into the reaction mixture remove the toothpick and streak onto antibiotic containing patch plates for future reference 3 Gently mix each reaction overlay each reaction with 30 ul of mineral oil and perform PCR using the following cycling parameters Number of cycles Temperature Length of time 1 cycle 94 C 4 minutes 50 C 2 minutes 72 C 2 minutes 30 cycles 94 C minute 56 C 2 minutes 72 C minute 1 cycle 72 C 5 minutes 12 pCMV Tag 1 Epitope Tagging Mammalian Expression Vector 4 Analyze the PCR products for the sizes of the gene inserted into the expression construct using standard 1 w v agarose gel electrophoresis Because the forward and reverse PCR sequencing primers are located on both sides of the MCS the expected size of the PCR product should be 167 bp plus the size of the insert Additional information can be obtained by further restriction analysis of the PCR products 5 For protocols for tran
4. sequence in the vector can be used and the FLAG sequence will be at the beginning of the protein The Bgl II site is located before the stop codon so translation may be terminated by a stop codon supplied either by the insert or by the vector Double Tagging with N Terminal FLAG and C Terminal c Myc To tag the protein of interest with FLAG at the N terminus and c myc at the C terminus the coding region of the gene should be cloned in between the Bgl II site and a restriction enzyme of choice in MCS 2 see Figure 3C The Kozak and stop codon sequences are supplied by the vector C Terminal c Myc Tag To tag the protein of interest at the C terminus with the c myc epitope tag the gene should be cloned between MCS 1 and MCS 2 see Figure 3D This allows for the use of the stop codon after the c myc tag However the Kozak sequence must be supplied with the insert Internal FLAG Tagging No Tag To tag the protein of interest internally with the FLAG tag the 5 portion of the gene including a Kozak sequence must be cloned within MCS 1 see Figure 3E The 3 portion of the gene must be cloned within the Bgl II site immediately after which the vector supplied stop codon appears To clone the gene of interest into the pCMV Tag 1 vector without any tag the gene including its own initiation and termination codon should be cloned into MCS 1 see Figure 3F pCMV Tag 1 Epitope Tagging Mammalian Expression Vector
5. by adding the following components to sterile 1 5 ml microcentrifuge tubes Control Experimental Ligation reaction components 1 2 3 41 59 Prepared pCMV Tag 1 vector 10ul 1 0nl OOul 1 0 ul 1 0 ul 0 1 pg p Prepared insert 0 1 ug l O Oul 0O 0p 1 0 Y ul Y ul rATP 10 mM pH 7 0 1 0ul 1 0ul 1 0ul 1 0 nN 1 0 ul Ligase buffer 10 x e 1 0nl 1 0 1 0 1 0 yl 1 0 ul T4 DNA ligase 4 U l O5ul OOu O5pl 0 5 ul 0 5 ul Double distilled ddH O to 10 ul 6 5ul 7 0nl 65p Zul Zul a This control tests for the effectiveness of the digestion and the CIAP treatment Expect a low number of transformant colonies if the digestion and CIAP treatment are effective 5 This control indicates whether the plasmid is cleaved completely or whether residual uncut plasmid remains Expect an absence of transformant colonies if the digestion is complete P This control verifies that the insert is not contaminated with the original plasmid Expect an absence of transformant colonies if the insert is pure a These experimental ligation reactions vary the insert to vector ratio Expect a majority of the transformant colonies to represent recombinants e See Preparation of Media and Reagents 2 Incubate the reactions for 2 hours at room temperature 22 C or overnight at 4 C For blunt end ligation reduce the rATP to 5 mM and incubate the reactions overnight at 12 14 C 10 pCMV Ta
6. cline 12 5 ug ml gt See Preparation of Media and Reagents On arrival prepare the following from the bacterial glycerol stock using the appropriate medium as indicated in the previous table Note The host strain may thaw during shipment The vial should be 5 stored immediately at 20 or 80 C but the strain remains viable longer if stored at 80 C It is also best to avoid repeated thawing of the host strain in order to maintain extended viability Revive the stored cells by scraping off splinters of solid ice with a sterile wire loop Streak the splinters onto an LB agar plate see Preparation of Media and Reagents containing the appropriate antibiotic if one is necessary Incubate the plate overnight at 37 C Seal the plate with Parafilm laboratory film and store the plate at 4 C for up to 1 week Restreak the colonies onto a fresh plate every week Preparation of a 80 C Bacterial Glycerol Stock 1 3 In a sterile 50 ml conical tube inoculate 10 ml of appropriate liquid medium containing antibiotic with one or two colonies from the plate Grow the cells to late log phase OD 69 0 8 1 0 Add 4 5 ml of a sterile glycerol liquid medium solution 5 ml of glycerol 5 ml of appropriate medium to the bacterial culture from step 1 Mix well Aliquot into sterile centrifuge tubes 1 ml tube This preparation may be stored at 20 C for 1 2 years or at 80 C for more than 2 yea
7. e actually occurs so long as 1 you perform such method with a DNA expression vector licensed from Sigma Aldrich Co and 2 you do not bind or allow others to bind an unlicensed antibody to any DYKDDDDK epitope of any fusion protein that is produced by use of the method This license does not include any rights under any other patents You are not licensed to use the vector and or antibody in any manner or for any purposed not recited above As used above the term unlicensed antibody means any antibody which Sigma Aldrich Co has not expressly licensed pursuant to Paragraph B above Sigma Aldrich Co hereby expressly retains all rights in the above listed patents not expressly licensed hereunder If the terms and conditions of this License Agreement are acceptable to you then you may open the vessel s containing the vector and or antibody and through such act of opening a vessel will have shown your acceptance to these terms and conditions If the terms and conditions of this License Agreement are not acceptable to you then please return the vessel s unopened to Agilent for a complete refund of your payment For additional licensing information or to receive a copy of any of the above patents please contact the Sigma Aldrich Co licensing department at telephone number 314 771 5765 pCMV Tag 1 Epitope Tagging Mammalian Expression Vector INTRODUCTION pCMV Tag 1 is an epitope tagging vector designed for gene expression
8. e isig Cc cean TE Q K L IS E ED L ATC AAG CTT ATC GAT ACC GTC GAC CTC GAG CAG AAA CTC ATC TCT GAA GAG GAT CTG Kpn I ia T7 promoter TAGGTACCAGGTAAGTGTACCCAATTCGCCCTATAGTGAGTCGTATTAC STOP Feature Nucleotide Position CMV promoter 1 602 T3 promoter and T3 primer binding site 5 AATTAACCCTCACTAAAGGG 37 620 639 multiple cloning site 1 Sac to BamH 651 692 FLAG tag 699 722 multiple cloning site 2 EcoR V to Xho 737 764 c myc tag 762 791 T7 promoter and T7 primer binding site 3 CGGGATATCACTCAGCATAATG 57 819 840 SV40 polyA signal 852 1235 fl origin of ss DNA replication 1373 1679 bla promoter 1704 1828 SV40 promoter 1848 2186 neomycin kanamycin resistance ORF 2221 3012 HSV thymidine kinase TK polyA signal 3013 3471 pUC origin 3600 4267 Figure 1 Circular map and polylinker sequence of the pCMV Tag 1 vector The entire sequence of the pCMV Tag 1 vector is available from www genomics agilent com or from the GenBank database Accession AFO25668 4 pCMV Tag 1 Epitope Tagging Mammalian Expression Vector EPITOPE TAGGING STRATEGIES WITH PCMV TAG 1 The gene of interest can be cloned into the pCMV Tag 1 vector so that the protein can be terminally tagged with FLAG or c myc If however the protein function will be disrupted by a terminal tag this vector also allows for internal tagging with FLAG see the following table and Figure 2 For C terminal tagging w
9. edevasedsensoeossdeenuesnoessovasseessecsenseovssssebsoseesaceesassedsssvensosecenees 14 Preparation of Media and Reagents scccsccccccscsscccssssecscsscsccssssccsseseessccsesccssssccessssssssesssseeees 14 References EAE A EE E E E TT ET 15 ENCMOteS ssccccscsssscssssssessesscsecssrsvessecsscssessecsscssesenessesessenecsasssnsseescsecsecssessesscesssenecssnssessesssnseessoesees 15 pCMV Tag 1 Epitope Tagging Mammalian Expression Vector MATERIALS PROVIDED Material provided Concentration Quantity pCMV Tag 1 mammalian expression vector 1 0 pg pl 20 ug pCMV Tag 1 control vector 1 0 pg pl 10 pg XL1 Blue host strain 500 ul Sufficient reagents are provided for 25 reactions and 1 control reaction b Genotype recAl endAl gyrA96 thi 1 hsdR17 supE44 relAl lac F proAB lacl ZAM15 Tn10 Tet STORAGE CONDITIONS XL1 Blue Host Strain Store immediately at 80 C All Other Reagents 20 C ADDITIONAL MATERIALS REQUIRED T4 DNA ligase Taq DNA polymerase Taq DNA polymerase buffer TE buffers NOTICES TO PURCHASER CMV Promoter The use of the CMV Promoter is covered under U S Patent Nos 5 168 062 and 5 385 839 owned by the University of Iowa Research Foundation and licensed FOR RESEARCH USE ONLY For further information please contact UIRF at 319 335 4546 S See Preparation of Media and Reagents Revision B Agilent Technologies Inc 2010 pCMV Tag 1 Epitope Tagging Ma
10. eesecsecssessecssessesesessessessenseesse 1 IDA ITA n I i EEEE E EEEE EE 3 Description of the V ectOtciewcuned Aono eii veel ete i eh ERER eee aed 3 pEMV Tag l Vector Map scien tevin etid e e tee ean cae ie a eee ete 4 C Teriinal FELEAG Tag norek veins e a e a oea ea iaa iSi as 6 N Terminal PLAG Tat mennene tied a aa a a eit needa iin 6 Double Tagging with N Terminal FLAG and C Terminal c Myc sesseeeereeeeereerereeree 6 C Termmale Mye Tacer nenene rp Ae a EAEE EE TE NEEE EEEE EE EE 6 Internal FLAG Tagihan na e a a tien ee en 6 INO MAS E E EE E TE 6 Preparation Of Host StrainS sesseesseosseossocssoossoossoossoossoossoosssosssosssosssosesosssoesssessessseessoossosssseessesssesss 8 Bacterial Host Strain inatesi eein ie e e E e a E E E E E AN decane 8 Preparing the pCMV Tag 1 Vector eesseesseossecssecssoossocssoossoossoossoossoossoosssosesosssesssesssesssesssesssesssesssesss 9 Ligating the INSEMC ssccscusssennscavssessetsoevnseseccecsddedunssvenesedcssedesssdosessdesacdscsacsucusecdusdecssseesunessvsdestassosuascsuaces 10 Transformation esseseesessesesecsosseseeocsoeseseceesoeseeoceoseeseeeesorseeeeeoseeseeeesosseseeeesoeseeoceoseeseeeesorseeoreoseeseeoeeoseee 11 Verification of Insert Percentage Size and Orientation e ssesesseesoesessoesossoesoosseesoesessoesossoesoeseseo 12 PCR Amplification of DNA from Individual Colonies ieee eesceseceseceeeceeeeeeeeeeneeenees 12 Troubleshooting eicccsccseisiseteccsennseserdsesvessocen
11. g 1 Epitope Tagging Mammalian Expression Vector TRANSFORMATION Transform competent bacteria with 1 2 ul of the ligation reaction and plate the transformed bacteria on LB kanamycin agar plates Refer to reference 4 in References for a transformation protocol Note The XL1 Blue cells supplied with the pCMV Tag 1 vector are not competent cells Refer to Hanahan 1983 for a protocol for producing competent cells Alternatively Agilent competent cells with transformation efficiencies 25 x 10 cfu ug are also available The control plasmid comprises the pCMV Tag 1 vector and the luciferase coding sequence 1 65 kb The firefly luciferase gene was cloned into the Bg1 II Xho I site of pCMV Tag 1 so that the luciferase protein is tagged with the FLAG epitope at the N terminus and with the c myc epitope at the C terminus pCMV Tag 1 Epitope Tagging Mammalian Expression Vector 1 VERIFICATION OF INSERT PERCENTAGE SIZE AND ORIENTATION Individual colonies can be examined to determine the percentage of vectors with inserts and the insert size and orientation by PCR directly from the colony or by restriction analysis PCR Amplification of DNA from Individual Colonies The presence and size of a DNA insert in the pCMV Tag 1 vector may be determined by PCR amplification of DNA from individual colonies 1 Prepare a PCR amplification reaction containing the following components 4 0 ul of 10x Tag DNA polymerase buffer 0 4 ul of
12. i dishes 25 ml 100 mm plate TE Buffer 10 mM Tris HCl pH 7 5 1 mM EDTA 14 pCMV Tag 1 Epitope Tagging Mammalian Expression Vector REFERENCES 1 Hopp T Prickett K Price V Libby R March C et al 1988 BioTechnology 6 1204 1210 2 Evan G I Lewis G K Ramsay G and Bishop J M 1985 Mol Cell Biol 5 12 3610 6 3 Kozak M 1991 J Biol Chem 266 30 19867 70 4 Hanahan D 1983 J Mol Biol 166 4 557 80 5 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press Cold Spring Harbor NY ENDNOTES FLAG is a registered trademark of Sigma Aldrich Co GenBank is a registered trademark of the U S Department of Health and Human Services Parafilm is a registered trademark of American Can Company Tween is a registered trademark of ICI Americas Inc MSDS INFORMATION Material Safety Data Sheets MSDSs are provided online at Attp www genomics agilent com MSDS documents are not included with product shipments pCMV Tag 1 Epitope Tagging Mammalian Expression Vector 15
13. in mammalian cells A target gene inserted into the pCMV Tag1 vector can be tagged with the FLAG epitope N terminal C terminal or internal tagging the c myc epitope C terminal or both the FLAG N terminal and c myc C terminal epitopes Tagged constructs generated in the pCMV Tag 1 vector can be transfected into mammalian cells and the tagged gene product can be easily characterized using commercially available tag specific antibodies The epitope tagging technique involves fusion of a protein of interest to a peptide epitope that is recognized by a readily available antibody In this technique expression of the fusion protein is monitored using a tag specific antibody allowing a new protein to be studied without generating a new specific antibody to that protein Epitope tagging can be used to localize gene products in living cells identify associated proteins track the movement of fusion proteins within the cell or characterize new proteins by immunoprecipitation Description of the Vector The pCMV Tag 1 vector see Figure 1 is derived from the pCMV Script vector and contains sequences for the FLAG and c myc epitopes These specific epitope tags are small highly immunoreactive and are not likely to interfere with the function of the target protein The synthetic FLAG epitope comprises eight amino acid residues DYKDDDDK The c myc epitope is derived from the human c myc gene and comprises 10 amino acid residues EQKLISEEDL
14. ith FLAG or c myc a translation initiation sequence must be supplied by the insert This may be supplied by the gene or engineered by PCR A perfect Kozak sequence is CCACCATGG although CCATGG or the core ATG is sufficient rt o Your Gene Your Gene Your Gene Your Gene Epitope tag Tag location Cloning site Kozak sequence A FLAG C terminus MCS 1 Insert supplied B FLAG N terminus Bgl II Vector supplied G FLAG and c myc N and C termini Bgl Il amp MCS 2 Vector supplied D c Myc C terminus MCS 1 amp 2 Insert supplied E FLAG Internal MCS 1 amp Bgl Il Insert supplied F No tag N A MCS 1 or MCS 1 amp 2 Insert supplied Your Gene FLAG emel Your Gene Your Gene FIGURE 2 Possible cloning positions for gene of interest pCMV Tag 1 Epitope Tagging Mammalian Expression Vector C Terminal FLAG Tag To achieve a C terminal FLAG tag on the protein of interest the gene must be cloned into MCS 1 see Figure 3A In this case the Kozak sequence for the translational start site must be supplied by the insert The FLAG tag will be picked up on the C terminus of the protein and the stop codon immediately downstream of the tag will cause translation to cease N Terminal FLAG Tag To achieve an N terminal FLAG tag on the protein of interest the gene should be cloned in at the Bgl II site see Figure 3B The Kozak
15. mmalian Expression Vector FLAG License Agreement The enclosed DNA expression vector and or antibody are specifically adpated for a method of producing selected protein molecules covered by one or more of the following patents owned by Sigma Aldrich Co U S Patent Nos 5 011912 4 703 004 4 782 137 and 4 851 341 EP Patent No 150 126 Austria Belgium Switzerland France United Kingdom Italy Netherlands and Sweden EP Patent No 335 899 Belgium Switzerland Germany France United Kingdom Italy Luxembourg and Sweden German Patent No P3584260 1 Canadian Patent No 1 307 752 and Japanese Patent Nos 1 983 150 and 2 665 359 Your payment includes a limited license under these patents to make only the following uses of these products A Vector License You may use the enclosed vector to transform cells to produce proteins containing the amino acid sequence DY KDDDDK for research purposes provided however such research purposes do not include binding an unlicensed antibody to any portion of this amino acid sequence nor using such proteins for the preparation of antibodies having an affinity for any portion of this amino acid sequence B Antibody License You may only use the enclosed antibody for research purposes to perform a method of producing a protein in which the protein is expressed in a host cell and purified by use of the antibody in accordance with a claim in one of the above patents in force in a country where the us
16. pCMV Tag 1 Epitope Tagging Mammalian Expression Vector Instruction Manual Catalog 211170 Revision B Research Use Only Not for Use in Diagnostic Procedures 211170 12 csi Agilent Technologies LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product No other warranties of any kind express or implied including without limitation implied warranties of merchantability or fitness for a particular purpose are provided by Agilent Agilent shall have no liability for any direct indirect consequential or incidental damages arising out of the use the results of use or the inability to use this product ORDERING INFORMATION AND TECHNICAL SERVICES Email techservices agilent com World Wide Web www genomics agilent com Telephone All Other Countries Please visit www genomics agilent com and click Contact Us pCMV Tag 1 Epitope Tagging Mammalian Expression Vector CONTENTS Materials Provided cscscssrssescesssssessssessesssrssessecsscssessecsscsssseossnecsessonsscesecssnssessecsseseosssecsessonseeese 1 Storage CONGIIONS cisisssssscossssscsacacsessessesscensecesssosvensoescecsasesosssoonsscedscesvsadeesssesesseesassevasesussscestssosseasesase 1 Additional Materials Required csscccssssccscssssecscsccsccssssccssssseessccsesccsssccessscesssccsssccesesceesesessees 1 Notices to Purchaser sccscssssssscscessssssssessssecssrssescecsscssessecssesessenscsssenss
17. rs pCMV Tag 1 Epitope Tagging Mammalian Expression Vector PREPARING THE pCMV TAG 1 VECTOR e Ensure that the coding sequence of the insert is in the correct reading frame We suggest dephosphorylation of the digested pCMV Tag 1 vector with CIAP prior to ligation with the insert DNA If more than one restriction enzyme is used the background can be reduced further by electrophoresing the DNA on an agarose gel and removing the desired vector band through electroelution leaving behind the small fragment that appears between the two restriction enzyme sites e After purification and ethanol precipitation of the DNA resuspend in a volume of TE buffer see Preparation of Media and Reagents that will allow the concentration of the plasmid DNA to be the same as the concentration of the insert DNA 0 1 ug ul pCMV Tag 1 Epitope Tagging Mammalian Expression Vector 9 LIGATING THE INSERT The ideal insert to vector molar ratio of DNA is variable however a reasonable starting point is a 2 1 insert to vector ratio The ratio is calculated using the following equation Number of base pairs of insert 0 1 wg of pCMV Tag vector 4576 bp of pCMV Tag vector X pug of insert where X is the quantity of insert in micrograms required for a 1 1 insert to vector molar ratio Multiply X by 2 to get the quantity of insert required for a 2 1 ratio 1 Prepare three control and two experimental 10 ul ligation reactions
18. sfection into mammalian cell lines please see Sambrook et al 1989 pCMV Tag 1 Epitope Tagging Mammalian Expression Vector 13 TROUBLESHOOTING Observation Suggestion Western analysis does not detect fusion protein insert is out of frame Insert is cloned out of frame Sequence to ensure correct reading frame Reclone if control Assay is not sufficiently sensitive or is being performed incorrectly Use a positive PREPARATION OF MEDIA AND REAGENTS 10x Taq DNA Polymerase Buffer 100 mM Tris HCl pH 8 8 15 mM MgCl 500 mM KCl 0 01 w v gelatin LB Agar per Liter 10 g of NaCl 10 g of tryptone 5 g of yeast extract 20 g of agar Add deionized H O to a final volume of 1 liter Adjust pH to 7 0 with 5 N NaOH Autoclave Pour into petri dishes 25 ml 100 mm plate LB Tetracycline Agar per Liter Prepare 1 liter of LB agar Autoclave Cool to 55 C Add 1 25 ml of 10 mg ml filter sterilized tetracycline Pour into petri dishes 25 ml 100 mm plate Store plates in a dark cool place or cover plates with foil if left out at room temperature for extended time periods as tetracycline is light sensitive 10x Ligase Buffer 500 mM Tris HCl pH 7 5 70 mM MgCl 10 mM dithiothreitol DTT Note rATP is added separately in the ligation reaction LB Kanamycin Agar per Liter Prepare 1 liter of LB agar Autoclave Cool to 55 C Add 5 ml of 10 mg ml filter sterilized kanamycin Pour into petr

Download Pdf Manuals

Related Search

Agilent pCMV Tag 1 Epitope Tagging Mammalian Expression Vector Instruction Manual

Related Contents

                    

Copyright © All rights reserved.